ID: 1148950125

View in Genome Browser
Species Human (GRCh38)
Location 17:51303400-51303422
Sequence GGGGCTTTATTTACATAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148950120_1148950125 27 Left 1148950120 17:51303350-51303372 CCAGGAAAAAGAAAAAAAAAAAG No data
Right 1148950125 17:51303400-51303422 GGGGCTTTATTTACATAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148950125 Original CRISPR GGGGCTTTATTTACATAAGA AGG Intergenic