ID: 1148960438

View in Genome Browser
Species Human (GRCh38)
Location 17:51388030-51388052
Sequence GAGTCCTGAACTTAGACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148960438_1148960443 16 Left 1148960438 17:51388030-51388052 CCACTGGTCTAAGTTCAGGACTC No data
Right 1148960443 17:51388069-51388091 GGAGTCTGCTGTTTGAGGGCAGG No data
1148960438_1148960442 12 Left 1148960438 17:51388030-51388052 CCACTGGTCTAAGTTCAGGACTC No data
Right 1148960442 17:51388065-51388087 ACTTGGAGTCTGCTGTTTGAGGG No data
1148960438_1148960439 -5 Left 1148960438 17:51388030-51388052 CCACTGGTCTAAGTTCAGGACTC No data
Right 1148960439 17:51388048-51388070 GACTCCAAAGATGAAGAACTTGG No data
1148960438_1148960441 11 Left 1148960438 17:51388030-51388052 CCACTGGTCTAAGTTCAGGACTC No data
Right 1148960441 17:51388064-51388086 AACTTGGAGTCTGCTGTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148960438 Original CRISPR GAGTCCTGAACTTAGACCAG TGG (reversed) Intergenic
No off target data available for this crispr