ID: 1148961723

View in Genome Browser
Species Human (GRCh38)
Location 17:51398934-51398956
Sequence CCTTCTATGGCCCCAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148961719_1148961723 23 Left 1148961719 17:51398888-51398910 CCTGTCAATAGTCTTCCTTTCAA No data
Right 1148961723 17:51398934-51398956 CCTTCTATGGCCCCAGCAGCTGG No data
1148961720_1148961723 8 Left 1148961720 17:51398903-51398925 CCTTTCAACAACTGTGCAGAAAT No data
Right 1148961723 17:51398934-51398956 CCTTCTATGGCCCCAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148961723 Original CRISPR CCTTCTATGGCCCCAGCAGC TGG Intergenic
No off target data available for this crispr