ID: 1148962612

View in Genome Browser
Species Human (GRCh38)
Location 17:51406067-51406089
Sequence GAGAAAGGCAGGTTTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148962612_1148962619 20 Left 1148962612 17:51406067-51406089 CCTCTCTGAAACCTGCCTTTCTC No data
Right 1148962619 17:51406110-51406132 AATACATCATGGGGTTCCTCTGG No data
1148962612_1148962617 10 Left 1148962612 17:51406067-51406089 CCTCTCTGAAACCTGCCTTTCTC No data
Right 1148962617 17:51406100-51406122 TGGATGTGATAATACATCATGGG No data
1148962612_1148962618 11 Left 1148962612 17:51406067-51406089 CCTCTCTGAAACCTGCCTTTCTC No data
Right 1148962618 17:51406101-51406123 GGATGTGATAATACATCATGGGG No data
1148962612_1148962621 22 Left 1148962612 17:51406067-51406089 CCTCTCTGAAACCTGCCTTTCTC No data
Right 1148962621 17:51406112-51406134 TACATCATGGGGTTCCTCTGGGG No data
1148962612_1148962616 9 Left 1148962612 17:51406067-51406089 CCTCTCTGAAACCTGCCTTTCTC No data
Right 1148962616 17:51406099-51406121 GTGGATGTGATAATACATCATGG No data
1148962612_1148962620 21 Left 1148962612 17:51406067-51406089 CCTCTCTGAAACCTGCCTTTCTC No data
Right 1148962620 17:51406111-51406133 ATACATCATGGGGTTCCTCTGGG No data
1148962612_1148962614 -10 Left 1148962612 17:51406067-51406089 CCTCTCTGAAACCTGCCTTTCTC No data
Right 1148962614 17:51406080-51406102 TGCCTTTCTCATCTGAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148962612 Original CRISPR GAGAAAGGCAGGTTTCAGAG AGG (reversed) Intergenic
No off target data available for this crispr