ID: 1148962616

View in Genome Browser
Species Human (GRCh38)
Location 17:51406099-51406121
Sequence GTGGATGTGATAATACATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148962612_1148962616 9 Left 1148962612 17:51406067-51406089 CCTCTCTGAAACCTGCCTTTCTC No data
Right 1148962616 17:51406099-51406121 GTGGATGTGATAATACATCATGG No data
1148962613_1148962616 -2 Left 1148962613 17:51406078-51406100 CCTGCCTTTCTCATCTGAAAAGT No data
Right 1148962616 17:51406099-51406121 GTGGATGTGATAATACATCATGG No data
1148962615_1148962616 -6 Left 1148962615 17:51406082-51406104 CCTTTCTCATCTGAAAAGTGGAT No data
Right 1148962616 17:51406099-51406121 GTGGATGTGATAATACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148962616 Original CRISPR GTGGATGTGATAATACATCA TGG Intergenic
No off target data available for this crispr