ID: 1148962621

View in Genome Browser
Species Human (GRCh38)
Location 17:51406112-51406134
Sequence TACATCATGGGGTTCCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148962615_1148962621 7 Left 1148962615 17:51406082-51406104 CCTTTCTCATCTGAAAAGTGGAT No data
Right 1148962621 17:51406112-51406134 TACATCATGGGGTTCCTCTGGGG No data
1148962612_1148962621 22 Left 1148962612 17:51406067-51406089 CCTCTCTGAAACCTGCCTTTCTC No data
Right 1148962621 17:51406112-51406134 TACATCATGGGGTTCCTCTGGGG No data
1148962613_1148962621 11 Left 1148962613 17:51406078-51406100 CCTGCCTTTCTCATCTGAAAAGT No data
Right 1148962621 17:51406112-51406134 TACATCATGGGGTTCCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148962621 Original CRISPR TACATCATGGGGTTCCTCTG GGG Intergenic
No off target data available for this crispr