ID: 1148962623 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:51406128-51406150 |
Sequence | TCTGGGGATTAGATGAAATA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1148962615_1148962623 | 23 | Left | 1148962615 | 17:51406082-51406104 | CCTTTCTCATCTGAAAAGTGGAT | No data | ||
Right | 1148962623 | 17:51406128-51406150 | TCTGGGGATTAGATGAAATATGG | No data | ||||
1148962613_1148962623 | 27 | Left | 1148962613 | 17:51406078-51406100 | CCTGCCTTTCTCATCTGAAAAGT | No data | ||
Right | 1148962623 | 17:51406128-51406150 | TCTGGGGATTAGATGAAATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1148962623 | Original CRISPR | TCTGGGGATTAGATGAAATA TGG | Intergenic | ||