ID: 1148965863

View in Genome Browser
Species Human (GRCh38)
Location 17:51435541-51435563
Sequence TTGGGCAGTTACGCAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148965853_1148965863 27 Left 1148965853 17:51435491-51435513 CCCTGTCTTGATATATCAGCTGT 0: 1
1: 18
2: 144
3: 303
4: 611
Right 1148965863 17:51435541-51435563 TTGGGCAGTTACGCAGCTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 105
1148965852_1148965863 28 Left 1148965852 17:51435490-51435512 CCCCTGTCTTGATATATCAGCTG 0: 1
1: 12
2: 145
3: 298
4: 506
Right 1148965863 17:51435541-51435563 TTGGGCAGTTACGCAGCTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 105
1148965854_1148965863 26 Left 1148965854 17:51435492-51435514 CCTGTCTTGATATATCAGCTGTG 0: 1
1: 4
2: 123
3: 298
4: 516
Right 1148965863 17:51435541-51435563 TTGGGCAGTTACGCAGCTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148965863 Original CRISPR TTGGGCAGTTACGCAGCTGC TGG Intergenic
908111651 1:60904183-60904205 TTGGGCAGCTGCACAGCTACTGG - Intronic
910265194 1:85331024-85331046 ATGGTCTGTTATGCAGCTGCTGG + Intronic
911284651 1:95974991-95975013 TTGGGCAGGCACTGAGCTGCAGG - Intergenic
912276266 1:108261925-108261947 TTGGGCAGGCACTGAGCTGCAGG + Intergenic
912291962 1:108432433-108432455 TTGGGCAGGCACTGAGCTGCAGG - Intronic
912587192 1:110777942-110777964 TTGAGCAGTTACTCACCTCCTGG + Intergenic
915046102 1:153018359-153018381 TTGGGCAGGCACTGAGCTGCAGG + Intergenic
918786260 1:188768578-188768600 TTGGGCAGGCACTGAGCTGCAGG + Intergenic
920183183 1:204145129-204145151 TTGGGCAGTCAGGCAGCTTAGGG + Intronic
921647406 1:217634597-217634619 TTTGGGAGTCACGCAGCTGGAGG - Intronic
922779493 1:228240398-228240420 TTGGGCAGATGCGTAGATGCAGG + Intronic
923662706 1:235972239-235972261 CTGGGCCGTGACGCTGCTGCGGG + Intergenic
1063281156 10:4630989-4631011 TCCGGCAGTTAAGGAGCTGCAGG - Intergenic
1067251981 10:44594202-44594224 TTGGGCAGGCACCAAGCTGCAGG + Intergenic
1069948151 10:72001417-72001439 TTGGGCTGTTATGTAGTTGCTGG + Intronic
1070103879 10:73414018-73414040 TTGGGCTGTGACGCTGCTGCTGG - Exonic
1072754189 10:98007507-98007529 TTGGGCAGTCTCCCAGCTCCAGG - Intronic
1073841026 10:107499206-107499228 TTGAGCAGTTATGCAGGTCCAGG - Intergenic
1078835663 11:15026850-15026872 TTGGGCAGTTACACATTTGGGGG - Intronic
1078874600 11:15380225-15380247 GGGGGCAGTTGCGCAGATGCTGG + Intergenic
1079927031 11:26506873-26506895 TGGGGCAGATAGGCAGCTCCAGG - Intronic
1081292104 11:41339013-41339035 TTGGGCTGTTAGGAAGCTTCTGG + Intronic
1081711824 11:45221776-45221798 TGGGGCAGTTTCACAGCTGTGGG + Intronic
1085908867 11:80797872-80797894 TTGGGCAGGCACTGAGCTGCAGG + Intergenic
1088008282 11:104968969-104968991 TTGGGCAGGCACTGAGCTGCAGG + Exonic
1088017780 11:105081523-105081545 TTGGGCAGGCACTGAGCTGCAGG + Intronic
1088020351 11:105111498-105111520 TTGGGCAGGCACTGAGCTGCAGG + Intergenic
1096113398 12:49041556-49041578 TAGGGCAGTCAGGCTGCTGCAGG + Intronic
1096673418 12:53213682-53213704 TTGTGCAGATACGCAGCATCTGG + Exonic
1100304609 12:93338870-93338892 GCGGGCAGTTACGAAGCAGCTGG - Intergenic
1103502749 12:121416306-121416328 TTGGGCCCTTCCGTAGCTGCTGG - Exonic
1104541521 12:129670339-129670361 TTTGGGAGTTATGCAGCTGGAGG + Intronic
1104798166 12:131534176-131534198 TTGGGCATTTTCACAGCTTCAGG - Intergenic
1105005405 12:132718113-132718135 GTGTGCAGGTAGGCAGCTGCTGG + Exonic
1106055342 13:26231825-26231847 TTGGGCTGTCCTGCAGCTGCAGG + Intergenic
1106255142 13:28015570-28015592 TTGGTAAGTTGGGCAGCTGCTGG - Exonic
1109083253 13:57934947-57934969 TTGGGCACTTACTCAGGTCCAGG + Intergenic
1112620185 13:101046988-101047010 CTGGGCAGATAAACAGCTGCAGG - Intergenic
1114946001 14:27681081-27681103 GTGTCCAGTTATGCAGCTGCAGG - Intergenic
1121669585 14:95697896-95697918 GTGGGTAGTCACGCAGGTGCAGG + Intergenic
1122502027 14:102207162-102207184 TTGGGCAGTTACTCAGCAGCAGG - Intronic
1127931362 15:63599674-63599696 AGGGGCAGTCACGGAGCTGCGGG + Intronic
1128402415 15:67297054-67297076 TGAGGCAGTTAGGCAGCAGCTGG + Intronic
1131577926 15:93610838-93610860 TTTAGGAGTTACGCAGCTGGAGG + Intergenic
1132012144 15:98285604-98285626 TTGCGCAGGTACACGGCTGCAGG + Intergenic
1138278173 16:55751353-55751375 TGGGGCAGCTACCCAGGTGCAGG - Intergenic
1138290502 16:55842592-55842614 TGGGGCAGCTACCCAGGTGCAGG + Intergenic
1146095933 17:29930199-29930221 GCGGGCGGTTCCGCAGCTGCGGG + Intronic
1146128932 17:30253143-30253165 CTGGGCAGTTAGGCAGGTGAAGG + Intronic
1148251167 17:46082241-46082263 ATGGTCAGCTACACAGCTGCAGG + Intronic
1148842112 17:50505655-50505677 TTGGGAAGTTACACAGCTTGTGG - Intergenic
1148965863 17:51435541-51435563 TTGGGCAGTTACGCAGCTGCTGG + Intergenic
1149277955 17:55065863-55065885 TTGGAGAGTAAGGCAGCTGCAGG + Intronic
1149656173 17:58310648-58310670 TTGGCCAGTGAGGGAGCTGCGGG + Exonic
1151298221 17:73201496-73201518 TTTGACAGATACGCAGATGCGGG + Exonic
1152609850 17:81310149-81310171 TTGGGGGGGTGCGCAGCTGCTGG - Intergenic
1153545905 18:6204410-6204432 ATGGGGAGTTACACGGCTGCTGG - Intronic
1156230788 18:35152265-35152287 TTGGGCAGGCACTGAGCTGCAGG - Intergenic
1158540966 18:58354219-58354241 GTGGCCAATTACTCAGCTGCTGG - Intronic
1159926795 18:74276839-74276861 TTTGGCAGCTACCCATCTGCAGG + Intronic
1160880485 19:1317490-1317512 GTGGGCAGTGAGGGAGCTGCTGG - Intergenic
1161668404 19:5590601-5590623 TGGGGCAGTGATGCAGCTGTAGG - Intronic
1164528948 19:29032855-29032877 TTGGGTAGATACTCAGCAGCGGG - Intergenic
930163497 2:48181291-48181313 TTGAGCAGCTACTCAGCTGCTGG - Intergenic
931061590 2:58535393-58535415 GTTGGCAGTTAGCCAGCTGCAGG + Intergenic
932349417 2:71020409-71020431 TTGGGCCGTAAAGGAGCTGCCGG - Intergenic
939249844 2:139669221-139669243 TTGGGCATTGACTCAGGTGCGGG - Intergenic
946830067 2:223719789-223719811 TTGGGCAGTTACACTTCTGATGG - Intergenic
947904383 2:233749712-233749734 GGGGGCAGTTTCGCACCTGCTGG + Intronic
1170994028 20:21334736-21334758 TTGGGCAGTTAGGAATTTGCTGG + Intronic
1172994379 20:39059231-39059253 TGGGGGAGATACGCAGCCGCAGG - Intergenic
1173210566 20:41028833-41028855 TTAGGCTGTTACACAACTGCTGG + Exonic
1175150606 20:56931024-56931046 ATGGGCAGTTTCGGAGCTGCGGG + Intergenic
1175629760 20:60525707-60525729 TTGGGCAGTGCCACAGGTGCTGG + Intergenic
1179549058 21:42131664-42131686 TTGGCCAGTGACTCAACTGCTGG + Intronic
949360095 3:3222312-3222334 TCTGGCAGTTACCCAGCTTCAGG - Intergenic
950497605 3:13343335-13343357 GTGGTGGGTTACGCAGCTGCAGG + Intronic
962887232 3:139638736-139638758 TTGGGCAGCTACGCAGAGGATGG - Intronic
968811981 4:2804279-2804301 TGGGGCAGTCCCGGAGCTGCTGG - Intronic
969392703 4:6901830-6901852 GTGGGCAGATGGGCAGCTGCGGG + Intergenic
969947358 4:10798275-10798297 CTGGGCAGATACCCAGCAGCGGG - Intergenic
976315504 4:83655001-83655023 TTGAGCAGTTCCCCAGCTCCTGG - Intergenic
978557565 4:109997319-109997341 TTTGGGAGTTACGCAGCTGGAGG - Intronic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
986542369 5:8859510-8859532 TTGGGCAGGAACGCAGATGGAGG + Intergenic
991283269 5:64940177-64940199 TTGGGCAGACACAGAGCTGCAGG - Intronic
992722932 5:79578468-79578490 TTGGGCAGTTACAAATCTGGGGG + Intergenic
996618630 5:125472370-125472392 TTGGGCATTTACTCTGCTCCAGG - Intergenic
997421444 5:133770237-133770259 TTGGGTAGATACTCAGTTGCTGG + Intergenic
1001002932 5:168024466-168024488 TTGGGGAGTTTCGAAGCAGCAGG + Intronic
1008215429 6:48782538-48782560 TTGTGCAGGTAAGCAGGTGCAGG + Intergenic
1011304471 6:85911093-85911115 TTGGGCAGGCACTGAGCTGCAGG + Intergenic
1012800877 6:103826100-103826122 TTGGGTATATACCCAGCTGCAGG - Intergenic
1015675920 6:135748559-135748581 TTGGGTATTTACCCAGCCGCAGG + Intergenic
1026369256 7:69682682-69682704 TTGTGCAGTTACTCAGCTGTTGG + Intronic
1033805099 7:144944749-144944771 TTTGGCAGTTAGGCTGCTGAGGG - Intergenic
1035774927 8:2180859-2180881 ATGGGCAGTGAGGCAGCTTCGGG + Intergenic
1047545258 8:125810394-125810416 TTGGGCCTTTTTGCAGCTGCTGG + Intergenic
1051298151 9:15618579-15618601 TTGGGCAGACACCAAGCTGCAGG - Intronic
1053575367 9:39354213-39354235 TTGGGCAGGTACTGAGCTGTAGG + Intergenic
1053839872 9:42182147-42182169 TTGGGCAGGTACTGAGCTGTAGG + Intergenic
1054096928 9:60912896-60912918 TTGGGCAGTTACTGAGCTGTAGG + Intergenic
1054118333 9:61188522-61188544 TTGGGCAGGTACTGAGCTGTAGG + Intergenic
1054589422 9:66994042-66994064 TTGGGCAGGTACTGAGCTGTAGG - Intergenic
1056220984 9:84450573-84450595 TTTGGGAGTCACGCAGCTGGAGG + Intergenic
1056800389 9:89686845-89686867 TTTGCCCGTTAGGCAGCTGCCGG - Intergenic
1056931419 9:90880957-90880979 TTGGGCAGCATGGCAGCTGCGGG + Intronic
1057129134 9:92641089-92641111 TTGGGCTGTGATGCAGCTGGTGG - Intronic
1057161339 9:92890467-92890489 TTGGGCAGATATGCACCTGTGGG + Intergenic
1060374458 9:123106084-123106106 TTGGGCCAGTACGCAGCTACAGG - Intergenic
1060502696 9:124174011-124174033 TTGAGGAGTCACGCAGCTGGAGG - Intergenic
1196851609 X:119943690-119943712 TTGGGCTGTTCCGCAGCGGCAGG - Exonic
1196900110 X:120374367-120374389 TTGGGCAGTTACAAATCTGGGGG - Intronic
1201593508 Y:15640459-15640481 TCGGGCAGATACTCAGCAGCTGG + Intergenic