ID: 1148969598

View in Genome Browser
Species Human (GRCh38)
Location 17:51468268-51468290
Sequence TCTCACTCTCTCCCCAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148969594_1148969598 6 Left 1148969594 17:51468239-51468261 CCTTTTCTTTTTTTCTTTTTGAG 0: 5
1: 116
2: 2552
3: 4076
4: 16447
Right 1148969598 17:51468268-51468290 TCTCACTCTCTCCCCAGGATGGG No data
1148969593_1148969598 21 Left 1148969593 17:51468224-51468246 CCTGATTTTCTTTTTCCTTTTCT No data
Right 1148969598 17:51468268-51468290 TCTCACTCTCTCCCCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148969598 Original CRISPR TCTCACTCTCTCCCCAGGAT GGG Intergenic
No off target data available for this crispr