ID: 1148969829

View in Genome Browser
Species Human (GRCh38)
Location 17:51470080-51470102
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148969829_1148969835 21 Left 1148969829 17:51470080-51470102 CCCCCCAAAAAACTACTTGAAAT No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148969829 Original CRISPR ATTTCAAGTAGTTTTTTGGG GGG (reversed) Intergenic