ID: 1148969830

View in Genome Browser
Species Human (GRCh38)
Location 17:51470081-51470103
Sequence CATTTCAAGTAGTTTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148969830_1148969835 20 Left 1148969830 17:51470081-51470103 CCCCCAAAAAACTACTTGAAATG No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148969830 Original CRISPR CATTTCAAGTAGTTTTTTGG GGG (reversed) Intergenic