ID: 1148969834

View in Genome Browser
Species Human (GRCh38)
Location 17:51470084-51470106
Sequence TGCCATTTCAAGTAGTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148969834_1148969835 17 Left 1148969834 17:51470084-51470106 CCAAAAAACTACTTGAAATGGCA No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148969834 Original CRISPR TGCCATTTCAAGTAGTTTTT TGG (reversed) Intergenic