ID: 1148969835

View in Genome Browser
Species Human (GRCh38)
Location 17:51470124-51470146
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148969827_1148969835 25 Left 1148969827 17:51470076-51470098 CCCACCCCCCAAAAAACTACTTG No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data
1148969825_1148969835 27 Left 1148969825 17:51470074-51470096 CCCCCACCCCCCAAAAAACTACT No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data
1148969824_1148969835 28 Left 1148969824 17:51470073-51470095 CCCCCCACCCCCCAAAAAACTAC No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data
1148969826_1148969835 26 Left 1148969826 17:51470075-51470097 CCCCACCCCCCAAAAAACTACTT No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data
1148969834_1148969835 17 Left 1148969834 17:51470084-51470106 CCAAAAAACTACTTGAAATGGCA No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data
1148969831_1148969835 19 Left 1148969831 17:51470082-51470104 CCCCAAAAAACTACTTGAAATGG No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data
1148969829_1148969835 21 Left 1148969829 17:51470080-51470102 CCCCCCAAAAAACTACTTGAAAT No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data
1148969833_1148969835 18 Left 1148969833 17:51470083-51470105 CCCAAAAAACTACTTGAAATGGC No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data
1148969830_1148969835 20 Left 1148969830 17:51470081-51470103 CCCCCAAAAAACTACTTGAAATG No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data
1148969828_1148969835 24 Left 1148969828 17:51470077-51470099 CCACCCCCCAAAAAACTACTTGA No data
Right 1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148969835 Original CRISPR GCAATGTAGTCTCACGTTCC AGG Intergenic
No off target data available for this crispr