ID: 1148974835

View in Genome Browser
Species Human (GRCh38)
Location 17:51518535-51518557
Sequence TAGCCTAGTTTATCTATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148974833_1148974835 12 Left 1148974833 17:51518500-51518522 CCTGACTGGTGAAGCAGGGAAGC No data
Right 1148974835 17:51518535-51518557 TAGCCTAGTTTATCTATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148974835 Original CRISPR TAGCCTAGTTTATCTATTGG TGG Intergenic
No off target data available for this crispr