ID: 1148984134

View in Genome Browser
Species Human (GRCh38)
Location 17:51606812-51606834
Sequence CTGGTCTACCAGCACACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148984134_1148984138 5 Left 1148984134 17:51606812-51606834 CCATTGGTGTGCTGGTAGACCAG No data
Right 1148984138 17:51606840-51606862 CAGGAAGAAGAAAAAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148984134 Original CRISPR CTGGTCTACCAGCACACCAA TGG (reversed) Intergenic
No off target data available for this crispr