ID: 1148986952

View in Genome Browser
Species Human (GRCh38)
Location 17:51631061-51631083
Sequence CTAGGATCCTTTGAGGGTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148986952 Original CRISPR CTAGGATCCTTTGAGGGTGC TGG (reversed) Exonic
901842569 1:11963389-11963411 GGAGGAACCTTTGAGGCTGCTGG + Intronic
905343674 1:37296812-37296834 CCACGATCCTTTGATGGAGCTGG - Intergenic
908775924 1:67639831-67639853 CTAGAATCCTTTGGGTGTACTGG - Intergenic
912000342 1:104825510-104825532 CAAGAATGCTTTGAGGGTGGGGG - Intergenic
915004130 1:152621239-152621261 CTAGTATCATTTGTGGGTGTTGG - Intergenic
917875638 1:179284474-179284496 TTGGGATCCTTTGAGGGCACAGG - Intergenic
918249309 1:182687266-182687288 CAAGGATCCCTTGAGGGGCCAGG - Intergenic
920714083 1:208323141-208323163 CTAGCATCCTTTGGGAGTGAAGG + Intergenic
924941445 1:248814846-248814868 CTAGCAGCCTTTGGGAGTGCTGG - Intronic
1071104726 10:82080963-82080985 TTAGGATGCTTTGAGTGTTCTGG + Intronic
1074697197 10:116060149-116060171 CTAGAATTCTTTGTGGGGGCTGG - Intronic
1074844283 10:117383452-117383474 CTAAGATCCCTTGAGGTTGGAGG - Intergenic
1076864803 10:133161288-133161310 CTCGGATCCCTGGAGGGTGAGGG - Intronic
1079268198 11:18956391-18956413 TCAGGATCCTTTGTGGGTCCCGG - Intergenic
1079334063 11:19555694-19555716 CTAGCATTCTCTGAGGGTGTGGG + Intronic
1079943176 11:26707937-26707959 CTAGAATCCTTGGGGGGAGCTGG - Intronic
1081554381 11:44144517-44144539 CTGGGAGCCTTTGAGGTGGCAGG - Intronic
1088092033 11:106053067-106053089 GAAGGATCTTTTGAGTGTGCAGG - Exonic
1089455109 11:118621452-118621474 CCCGGAGCCTTTGAGGGGGCGGG - Intronic
1093727988 12:22537796-22537818 CTAGGAACCTTTGAGGGAACAGG - Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1103748830 12:123144927-123144949 TTAGGCTCCTTTGAGCCTGCGGG - Intronic
1104142932 12:126005793-126005815 CTGGGACCTTTTAAGGGTGCAGG - Intergenic
1104335806 12:127893864-127893886 CAAGGATCCTGGGAGGGAGCTGG - Intergenic
1107358136 13:39590226-39590248 CAAGGGTCCCTTCAGGGTGCAGG + Intronic
1108552311 13:51558884-51558906 CTAAAAGTCTTTGAGGGTGCAGG - Intergenic
1113328520 13:109307024-109307046 CTAGGATGTGTTGCGGGTGCTGG + Intergenic
1115645287 14:35365166-35365188 CTGGAATCCTTTGAGGGGGTAGG - Intergenic
1125236781 15:37523952-37523974 GCAGGATGCTGTGAGGGTGCTGG + Intergenic
1125340177 15:38667815-38667837 TTAGGAACCTTCCAGGGTGCAGG + Intergenic
1126468893 15:48985899-48985921 CCAGGCCACTTTGAGGGTGCTGG + Intergenic
1128744363 15:70103187-70103209 CAAGGACCCTTGGAGTGTGCAGG + Intergenic
1129898512 15:79127281-79127303 TTTGAATCCTTTGAGAGTGCTGG - Intergenic
1139186389 16:64810666-64810688 CTAGGATCCATTGAGCCTTCTGG - Intergenic
1143270704 17:5672659-5672681 CAAGGACCCTAGGAGGGTGCTGG - Intergenic
1148986952 17:51631061-51631083 CTAGGATCCTTTGAGGGTGCTGG - Exonic
1150227795 17:63533294-63533316 CCAGGACCCGTTGAGGGTCCAGG + Intronic
1152927294 17:83093085-83093107 TGAGGATCCTTTGACGGTGGTGG + Intronic
1154961204 18:21310629-21310651 CTGAGATCCTTTCAGGGTGTCGG - Intronic
1160202683 18:76808573-76808595 CTGGAATTCTTTGAGGGTGATGG - Intronic
1160483335 18:79263254-79263276 CTGGTATCCATGGAGGGTGCTGG - Intronic
1165372303 19:35416674-35416696 CTAGGTTCCTGTGAGGGTCTCGG - Intergenic
925837368 2:7959376-7959398 CCAGGATCCTTTGAGAAAGCAGG - Intergenic
931598857 2:63981782-63981804 CTAGGATCGTTTAATGCTGCTGG + Exonic
932354546 2:71058330-71058352 CTGGGATCCTCAGTGGGTGCTGG + Intergenic
933154200 2:78953672-78953694 CCATAGTCCTTTGAGGGTGCTGG + Intergenic
933893847 2:86792848-86792870 CTTGGATGCTTTGAGGGAGCTGG - Intronic
1171138554 20:22720538-22720560 CTGGGACCCCTTGAGGGTGGAGG - Intergenic
1173647302 20:44641446-44641468 CTAGCAGCCTTGGAGGGGGCAGG + Intronic
1175298734 20:57927911-57927933 CCAGAATGCTTTGAGGGTGGGGG - Intergenic
1178156401 21:29858871-29858893 CTAGGATCCTTTGATCCTGTGGG - Intronic
1181532215 22:23523113-23523135 CCAGGCGCCTTTGAGGGTGGAGG - Intergenic
951220133 3:20059850-20059872 CAAGGATCCTTTGGAGGTGATGG - Intronic
951422592 3:22504953-22504975 CTAAGATCCTTTGAGTTTGAAGG + Intergenic
958057756 3:88434978-88435000 CTAAGAGCCTTTGCGGGGGCAGG - Intergenic
962599542 3:136980898-136980920 CTCAGATCCTTTAAGGGTGGAGG + Intronic
975224264 4:71852186-71852208 GTATGATCCTTTGAGTGTGATGG + Intergenic
979270129 4:118749726-118749748 CTAGGCTGCTTAGAGTGTGCTGG - Intronic
982381617 4:154755034-154755056 CTAGAGTCATTTGAGGATGCAGG - Intergenic
987734530 5:21823801-21823823 GTAGGATCCTTTGAAGGTTGGGG - Intronic
988854473 5:35214505-35214527 CTAGGCCCTTTTGAGGGTGGAGG - Intronic
992396277 5:76372186-76372208 AGAGGCTCCTTTGAGGCTGCTGG - Intergenic
999640942 5:153672709-153672731 CTAGGATCCCAAGAGGGAGCTGG + Intronic
1002446170 5:179291351-179291373 CACGGAACCTTTGAGGGTGTGGG - Intronic
1007738045 6:43994163-43994185 GTAGGATCCCTTGAGGGAGGAGG + Intergenic
1010700150 6:79034892-79034914 CTAATATTCTTTGAGTGTGCGGG + Intronic
1020352288 7:7234015-7234037 CCAGGATCCTTTGTGGATCCAGG - Intronic
1022355137 7:29607512-29607534 CATGGGTCCTTTGAGGGAGCAGG - Intergenic
1022611475 7:31878644-31878666 CTGGGATGCTTTGAGGTTGCTGG - Intronic
1026763556 7:73144662-73144684 GGAGGATCGTTTGAGGCTGCAGG + Intergenic
1027083613 7:75247928-75247950 GGAGGATCGTTTGAGGCTGCAGG - Intergenic
1030328850 7:108251600-108251622 ATTAGATCCTTTGAGGCTGCTGG + Intronic
1034584875 7:152081011-152081033 CAAGGCTCCATTCAGGGTGCTGG - Intronic
1036640661 8:10581446-10581468 CTAGAACACTTTGGGGGTGCAGG - Intergenic
1036647535 8:10621111-10621133 ATAGGGTACTTTGATGGTGCTGG + Intronic
1040706083 8:50129419-50129441 TTGGGGTCCTCTGAGGGTGCTGG - Intronic
1045555391 8:103209922-103209944 CTAGGCTCTTCTGTGGGTGCTGG + Intronic
1048132773 8:131716138-131716160 CTAGGATCTGTTGGGGGTGGGGG + Intergenic
1049273054 8:141706308-141706330 CTAGGATCATATAAGGGGGCGGG + Intergenic
1052857659 9:33417156-33417178 CAAGGACCATTTGAGGGTGAGGG + Intergenic
1055938896 9:81630197-81630219 CGAGGATCCCTTAAGGGTCCCGG + Intronic
1058745996 9:107991431-107991453 CTAGGATCCCTAGAGGATGCTGG + Intergenic
1060683500 9:125586529-125586551 CTTGCATGCCTTGAGGGTGCAGG - Intronic
1062418261 9:136465007-136465029 CTTGGATCCTTTCAAAGTGCTGG - Intronic
1062610801 9:137372603-137372625 CTAGGACCCTGTGAGTGTGAGGG + Intronic
1192604569 X:72502449-72502471 CTGGGATCTATTGAGGGTGGAGG + Intronic