ID: 1148990669

View in Genome Browser
Species Human (GRCh38)
Location 17:51664032-51664054
Sequence TCCCATGAGAACCACTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148990667_1148990669 21 Left 1148990667 17:51663988-51664010 CCTTTTCTCTTTTAGGATTGTTG 0: 1
1: 0
2: 3
3: 33
4: 451
Right 1148990669 17:51664032-51664054 TCCCATGAGAACCACTGTACTGG 0: 1
1: 0
2: 0
3: 7
4: 125
1148990665_1148990669 28 Left 1148990665 17:51663981-51664003 CCAAATACCTTTTCTCTTTTAGG 0: 1
1: 0
2: 6
3: 35
4: 411
Right 1148990669 17:51664032-51664054 TCCCATGAGAACCACTGTACTGG 0: 1
1: 0
2: 0
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148990669 Original CRISPR TCCCATGAGAACCACTGTAC TGG Intronic
900318800 1:2072484-2072506 TCCCATGGAAACCACAGTAAAGG - Intronic
900462561 1:2808659-2808681 TCCCATCAGTACCACTGCTCGGG + Intergenic
901952183 1:12758068-12758090 TCCCATGGAAACCACAGTAAAGG + Intronic
916368838 1:164065813-164065835 TCCCATGACAGCCACTGAAACGG - Intergenic
916388476 1:164304358-164304380 TCCCATGAGAAACCCAGTAAAGG - Intergenic
919327007 1:196120741-196120763 TCCTATGAGAATCACCCTACTGG - Intergenic
919338504 1:196270964-196270986 TCACATTAGAATCACTGTACTGG - Intronic
921836422 1:219783297-219783319 TCCCATGAGAAAAACTGAAATGG + Intronic
923937391 1:238778412-238778434 TTACATGATATCCACTGTACTGG + Intergenic
924405339 1:243739098-243739120 TCCTATGAGAGCCTCTGAACTGG + Intronic
1066038454 10:31519524-31519546 TCCCAGGATAAACACTGTAGTGG - Intronic
1068020229 10:51572758-51572780 TAGCTTGAGAACCACTGGACTGG + Intronic
1068785320 10:60966544-60966566 TCACATAATAACCACTGTAGTGG - Intronic
1070811296 10:79299333-79299355 TCCCATGACAACCGCAGGACAGG - Intronic
1077047233 11:551990-552012 CCCCACGAGAACCAGTGTCCAGG + Intronic
1078492380 11:11781444-11781466 TCCTATGTGCACCACTGCACAGG - Intergenic
1079431105 11:20388626-20388648 TCACCTGAGAAGCTCTGTACTGG - Intronic
1080873826 11:36259327-36259349 ACCCCTGGGAACCACTGTGCTGG + Intergenic
1083705009 11:64508167-64508189 TCCCATGAAAACCCCAGTAAGGG + Intergenic
1087653382 11:100894947-100894969 TCCCATGAGGAACACTTCACAGG - Intronic
1100168266 12:91943160-91943182 TTCCATCTGAACCACTTTACTGG - Intergenic
1104229845 12:126874216-126874238 TCCCATGATAACTAGTGTAATGG - Intergenic
1105263001 13:18793638-18793660 GCCCATGAGAGCCACTGTGGAGG - Intergenic
1106365596 13:29076608-29076630 CCCCATGTGAACCTCTGGACGGG + Intronic
1107101661 13:36599874-36599896 TCCCATGGAAACCACTATAAAGG - Intergenic
1107226903 13:38061028-38061050 GCCCATGAGAACCATAGGACTGG - Intergenic
1108385222 13:49893588-49893610 TCCCATGGAAGCCACTGTAAAGG - Intergenic
1108590396 13:51907608-51907630 TCCCATGGAAACCACCGTAAAGG + Intergenic
1109127141 13:58531592-58531614 TCCCATGGAAACCACCGTAAAGG - Intergenic
1110103105 13:71634318-71634340 AGCCATGAGAAGCACTGGACTGG - Intronic
1111164000 13:84433284-84433306 GCCCATGAGAAACATTTTACCGG + Intergenic
1122219477 14:100227282-100227304 GCACATGTGAGCCACTGTACAGG - Intergenic
1124163299 15:27294570-27294592 CCCCGTAAGAACCACTGCACTGG - Intronic
1127726370 15:61753847-61753869 TTCCATCAGCACCACTGCACTGG + Intergenic
1128175947 15:65555828-65555850 TCCCATGAAAATGACTGTCCTGG - Intronic
1128603332 15:69015951-69015973 GCCCCAGAGAACCACTGTCCTGG - Intronic
1130518288 15:84643015-84643037 TCCCATGAGACCCACTCAAGAGG + Exonic
1130713676 15:86310593-86310615 TCCCCTGAGATCCAGTGAACAGG - Intronic
1131497803 15:92929774-92929796 TAACATGAGAACCCCTGAACTGG - Intronic
1131888963 15:96951687-96951709 TCTAATGAGAACCACTGCTCTGG + Intergenic
1135852922 16:25980874-25980896 TCCCATGAAAACCACAATAAAGG - Intronic
1138842923 16:60530842-60530864 TCCCATGAAAACCACAATAAAGG + Intergenic
1148990669 17:51664032-51664054 TCCCATGAGAACCACTGTACTGG + Intronic
1152844288 17:82590273-82590295 TAGGATGAGAACCACTGCACAGG + Intronic
1154428038 18:14287145-14287167 GCCCATGAGAGCCACTGTGGAGG + Intergenic
1154430751 18:14306657-14306679 GCCCATGAGAGCCACTGTGGAGG + Intergenic
1157131547 18:45012289-45012311 TCCCATGATAACCACAATACAGG - Intronic
1157429494 18:47612997-47613019 TCCCATGATAAAAAATGTACAGG + Intergenic
1157796784 18:50582184-50582206 TCAGATGAGAACCACTGGGCTGG + Intronic
1160175631 18:76591951-76591973 TCCCTTGACAACTACTGAACAGG - Intergenic
1161606007 19:5215381-5215403 TCCCATGTGAACTGCTGTCCAGG + Exonic
1164522975 19:28992807-28992829 TTCCATGGGAACCACAGTAAAGG + Intergenic
925633162 2:5915734-5915756 GCCCATGCTAACCACAGTACTGG - Intergenic
927469601 2:23363101-23363123 CCCCATGAGACCCACTGCCCCGG + Intergenic
930514172 2:52384517-52384539 TCCCATGTGCACCGCTGTCCAGG - Intergenic
931677686 2:64713949-64713971 TCTCATGAGAACCACTGGCAAGG - Intronic
932740542 2:74287545-74287567 GCCCATGAGCCCCACTGTAAGGG + Intronic
933810621 2:86030750-86030772 TCACTTGGGAACCACTGAACTGG + Intronic
937457683 2:122056983-122057005 AAGCATGAGAACCACTGTGCTGG + Intergenic
937986503 2:127640477-127640499 ACCCATGAGAACCACCCTTCCGG + Intronic
940026898 2:149218003-149218025 TCCAATGAGAATCACAGTAGTGG + Intergenic
940176321 2:150881247-150881269 TCCCATGAAAACCACAGTAAAGG + Intergenic
941973991 2:171383469-171383491 TCCCATGGTAAAAACTGTACTGG + Intronic
947876083 2:233469073-233469095 CCTCATGAGAGCCACTGTCCAGG - Intronic
948061375 2:235045171-235045193 TCCCGTGAGAGCCTCTGTGCGGG + Intronic
1173613298 20:44386568-44386590 TCCACTGAGAACCACTGTGCTGG - Intronic
1174350688 20:49965426-49965448 TTCCATGAGATCCACTTTCCTGG - Intergenic
1175337653 20:58206666-58206688 TCCAAAGAGAAGCACTTTACTGG + Intergenic
1175775185 20:61648621-61648643 TACCATCAGAACCACTGCAGGGG + Intronic
1176846726 21:13882280-13882302 GCCCATGAGAGCCACTGTGGAGG - Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1180557718 22:16591414-16591436 TCCCCTGAGAACCACAGTGAGGG + Exonic
1181114122 22:20620681-20620703 TCCCAGGAGACCCTCTGCACAGG - Intergenic
1184705592 22:46210737-46210759 TCCAATGAGAACAACTGGCCAGG - Intronic
950763941 3:15259361-15259383 AACTTTGAGAACCACTGTACTGG - Intronic
950973263 3:17211409-17211431 TCCAATGTGAACCACCCTACTGG - Intronic
953880050 3:46686811-46686833 TCCCCTGAAAACCACAGGACAGG + Intronic
956700285 3:71952783-71952805 CTCCTTGAGAACCACTGTAATGG - Intergenic
958025643 3:88045787-88045809 TCCCAGGATAACCACTGTATTGG + Intergenic
958893311 3:99804285-99804307 TATCATGAGAACCACTGCATGGG + Intergenic
960322776 3:116257031-116257053 TCCCATGAAAACCACTCTCAGGG - Intronic
968225721 3:196970750-196970772 TCCCTGGAGAGCCACTGTAAAGG + Intergenic
970802406 4:19989084-19989106 TACCCTAAGAATCACTGTACTGG - Intergenic
972161836 4:36236696-36236718 TCCATTGGGAACCACTGTTCTGG - Intronic
977670843 4:99693257-99693279 TCCCATGAAAACCACCATAATGG + Intergenic
984798037 4:183684296-183684318 TCCCATCTGAACCACTATAAAGG - Exonic
984869992 4:184317305-184317327 TCCCAAGATGACCACTGTTCTGG + Intergenic
985689140 5:1297451-1297473 TCCCATGGGACCCACTGCAGGGG - Intergenic
986631693 5:9780211-9780233 TCCCAGGAGAATTGCTGTACAGG - Intergenic
987772711 5:22327388-22327410 TACCATGAGAGCCACTGACCGGG + Intronic
990555947 5:56935946-56935968 AGCCATGAGAGCCACTGCACCGG - Intronic
991998666 5:72414105-72414127 TCCTAAGAAAATCACTGTACAGG - Intergenic
992655461 5:78905612-78905634 TGCCATGTGAACCACTGCCCAGG - Intronic
993499153 5:88644832-88644854 TCCCATTAGAACCTCAGGACAGG - Intergenic
998529330 5:142870664-142870686 TCCAGTGAGAAACACTGTATAGG - Intronic
1002095822 5:176830142-176830164 TGCCATGAGAACCGCTCTAAGGG + Intronic
1002284740 5:178154611-178154633 TCCCATGGGAAACACTGAAACGG - Intergenic
1006925676 6:37653880-37653902 TCACATAGAAACCACTGTACAGG + Intronic
1011845602 6:91560195-91560217 GCCCATGAGAGCAACTGTAGGGG - Intergenic
1014293377 6:119587696-119587718 TTCCATGAGAAACCCTGTTCTGG - Intergenic
1016606988 6:145940980-145941002 ACTAATGAGAACCACTGTACTGG - Intronic
1016743587 6:147554195-147554217 TATCATGAGAACAACAGTACGGG + Intronic
1017448094 6:154527509-154527531 TCCCGTGTGAACCACAGCACTGG - Intergenic
1018572684 6:165227233-165227255 TCCCATGACAAGTACTGTGCCGG + Intergenic
1020180013 7:5915009-5915031 ACACATGAGAACTACTGTTCTGG - Intronic
1020302921 7:6809873-6809895 ACACATGAGAACTACTGTTCTGG + Intronic
1021208995 7:17821508-17821530 CCACATGAGAATCACTGAACAGG - Exonic
1024352475 7:48381035-48381057 TCCCTTGAAAACCACAGTAAAGG + Intronic
1029777783 7:102696720-102696742 ACCCAAGATAACCACTCTACTGG - Intergenic
1031724178 7:125216233-125216255 ACCCATAAGAACCACCTTACTGG + Intergenic
1034619598 7:152446591-152446613 TCCCCTGAGAACCACGGTGAGGG - Intergenic
1036622247 8:10431943-10431965 TCCCATGGAAACCACAGTAGAGG + Intergenic
1037741970 8:21615530-21615552 TCCCAGGGAAACCACTGTAAAGG + Intergenic
1039183477 8:34891817-34891839 TCCCCTGAGATCCACTTTTCGGG + Intergenic
1044489014 8:92789887-92789909 TCCCCTTAGAACTCCTGTACTGG + Intergenic
1044613133 8:94114058-94114080 CCCCATGAGATCCATTTTACAGG - Intergenic
1047461145 8:125066616-125066638 AGCCATGAGAACCACTGGAAAGG - Intronic
1048502138 8:134988041-134988063 GACCATGAGAACCCCTGAACTGG - Intergenic
1048911635 8:139140965-139140987 TCCCATGAGAACCAGGGAAGTGG - Intergenic
1048997792 8:139804867-139804889 TCCCATGAGGACCCCTGTATGGG + Intronic
1053407000 9:37886040-37886062 TCCCTTAAGTACAACTGTACAGG + Intronic
1055903900 9:81270919-81270941 CCCCATGAGGACATCTGTACAGG + Intergenic
1056450611 9:86713045-86713067 CCCCATGAGAAACACTGTTGAGG + Intergenic
1056671190 9:88628458-88628480 TACTTTGAGAACCACTTTACTGG + Intergenic
1056814751 9:89793009-89793031 TCCCTTGAAAACCCCTGGACTGG - Intergenic
1056956637 9:91087414-91087436 CACCATGAGAACCTCTGCACAGG + Intergenic
1061614913 9:131773289-131773311 TCCCATGGGAACCACAATAAAGG + Intergenic
1061834986 9:133322908-133322930 TCCCATGGAAACCACATTACGGG + Intergenic
1189635916 X:43009107-43009129 TACCATGTGATCCTCTGTACAGG + Intergenic
1189875050 X:45427570-45427592 TACCTTGAGAACCATTGTTCTGG + Intergenic
1196087270 X:111697510-111697532 CCACTTGAGAACCACTGTTCTGG + Intronic
1197891681 X:131275710-131275732 CCCCATGGGAACCACAGAACTGG + Exonic
1198706308 X:139452224-139452246 TCCCATGGGGACCTATGTACTGG - Intergenic