ID: 1148992730

View in Genome Browser
Species Human (GRCh38)
Location 17:51680568-51680590
Sequence CCTGTTCCCCAGGGAGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 2, 2: 3, 3: 17, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148992723_1148992730 15 Left 1148992723 17:51680530-51680552 CCAGTGGTTCTCAAAGTTGGGGA 0: 1
1: 0
2: 8
3: 76
4: 499
Right 1148992730 17:51680568-51680590 CCTGTTCCCCAGGGAGTGTTTGG 0: 1
1: 2
2: 3
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148992730 Original CRISPR CCTGTTCCCCAGGGAGTGTT TGG Intronic
900354079 1:2251529-2251551 CCTGGTCCCCAGGTCGTGTGGGG + Intronic
900617945 1:3573698-3573720 TCTGTGCCCCAGGGAGTGGTGGG - Intronic
901197358 1:7447601-7447623 CCTGAGCCCCAGGGAGGGTTAGG - Intronic
901510715 1:9716897-9716919 CCTGGTGTCCAGGGAGTGGTTGG + Intronic
902966915 1:20011872-20011894 TCTGTTCTCCAGGGGGTGGTGGG + Intergenic
903273782 1:22208280-22208302 CTTACTCCCCAGGGGGTGTTTGG + Intergenic
903565405 1:24261557-24261579 CCTGTCTCCCAGGGAGTATGGGG + Intergenic
903850161 1:26301117-26301139 ACTGTGCCCCAGGGAGTTTGAGG + Intronic
904422086 1:30400688-30400710 GCTGTTCCCCAGGAAGTGATGGG - Intergenic
906286096 1:44588792-44588814 CCTGAACCCCAGGTAGGGTTGGG - Intronic
906778643 1:48552666-48552688 TGTTTGCCCCAGGGAGTGTTTGG - Intronic
907495737 1:54843106-54843128 CTCCTTCCCCAGGGATTGTTAGG + Intergenic
908043776 1:60145703-60145725 TCTATCCCCCAGGGGGTGTTTGG + Intergenic
908043845 1:60146770-60146792 CCTCTTACCCAGGGAGAATTAGG + Intergenic
908363932 1:63398205-63398227 CCTGTTCCCTAGTCAGAGTTTGG + Intronic
908667496 1:66509677-66509699 CCTGTTCCCCAAGAGCTGTTGGG - Intergenic
910939202 1:92515034-92515056 CCTTCTCCCCAGGGGGAGTTGGG - Intronic
911270633 1:95797365-95797387 CCTGTTTCCAGGGGAGTGATTGG - Intergenic
915016614 1:152740056-152740078 GCTGCTCCCCAGGGAATATTTGG + Intronic
915322779 1:155064877-155064899 CCTGTTCTCCAGAGAGTCTGTGG - Intronic
916368424 1:164061147-164061169 CCTGTTCCCCAGCGACTCCTAGG + Intergenic
917895565 1:179484093-179484115 CCTGGTCCCCAGTGACTCTTGGG + Intronic
918384657 1:183993563-183993585 CTTGTTCCTCAGGGAGTCATTGG - Intronic
920849475 1:209618817-209618839 CCTGTTCTCCAGGGATTTCTGGG + Intronic
923238524 1:232058327-232058349 CATGTTGCCCAGCTAGTGTTGGG + Intergenic
924660829 1:246015155-246015177 TCTGTCCCCCAGGGCGTGGTAGG + Intronic
1067580179 10:47439761-47439783 GCTGGTCCCCAGGGAGTTGTGGG - Intergenic
1077186278 11:1236789-1236811 CCGGTTCCCCAGGCAGTGCCTGG - Intronic
1080755091 11:35189643-35189665 CCTCATCCCCAGGGTGTGTGGGG + Intronic
1084213706 11:67635479-67635501 CTTGCTCCCCAGAGAATGTTTGG + Intronic
1085203033 11:74713214-74713236 CCAGATCCCCAGGCAGTGCTGGG - Intronic
1086939266 11:92778748-92778770 TATGTTTCCCAGGGAGTGTCGGG - Intronic
1089362857 11:117902484-117902506 CCTGTTCCCCAGGCAGAGAAGGG + Intronic
1090071267 11:123546581-123546603 CCTGTTCCCCAGTGAGGTCTGGG + Intronic
1090247963 11:125230125-125230147 CCTGTGCCACAGGCAGTGCTGGG - Intronic
1091629697 12:2150372-2150394 CCTGTTCCCCAGGGAATGTTGGG - Intronic
1091750433 12:3018664-3018686 CCTGGGCCCCAGGGTGTGCTGGG + Intronic
1091952366 12:4605038-4605060 CCTGTTCCCCGGGGAGAATGAGG + Exonic
1095527454 12:43144399-43144421 TCTCTTCCACATGGAGTGTTAGG + Intergenic
1095669133 12:44837392-44837414 TTTGTCCCCCAGGGAATGTTTGG - Intronic
1095925083 12:47570304-47570326 CCTTTTCCACAGGGAGTGCCTGG - Intergenic
1096533446 12:52256287-52256309 GCTGTTCCCCAAGGAGGGCTGGG - Intronic
1096585803 12:52618846-52618868 GCTGTTCCCCAGGGAGTGGTGGG + Intergenic
1096677455 12:53233328-53233350 CCAGTCCCCATGGGAGTGTTTGG - Intergenic
1096836269 12:54353308-54353330 CCTCTTTCCCAGGGAATGCTGGG + Intergenic
1096843901 12:54395009-54395031 CCTTCTCCCTTGGGAGTGTTGGG + Intergenic
1102057556 12:109908031-109908053 CCTGCTCCCCACGGAGAGCTGGG - Intronic
1103026044 12:117574841-117574863 CCTGTCACCCAGGGAGTTTCTGG + Intronic
1103223677 12:119267885-119267907 CCTGTTCCAAAGGGAGTAGTTGG - Intergenic
1103864392 12:124040346-124040368 CCTGATCCCCAGGAAGTCCTAGG - Intronic
1104420021 12:128627533-128627555 CCAGTCCCCCAGGGAGTGTCTGG - Intronic
1104641903 12:130472429-130472451 CCTGCTCCACGGGGAATGTTTGG - Intronic
1107556579 13:41520967-41520989 CCGCTTCCCCAGGGACTGCTTGG - Intergenic
1108355235 13:49624065-49624087 GCTGTTTCCCAGGGAGGGTCTGG + Intergenic
1110157537 13:72335936-72335958 CATGTTTCCCAGAGACTGTTAGG - Intergenic
1116452651 14:45082565-45082587 ACTGTTACGCAGGGACTGTTTGG - Intergenic
1119310567 14:73642988-73643010 CCTGTTCACCAGAGAATGTGTGG - Intergenic
1121299687 14:92860757-92860779 CATGTTCCCCTGGGAGTCCTTGG - Intergenic
1122083129 14:99280680-99280702 CCTGTCCCCCATGGTGTGCTTGG - Intergenic
1122854620 14:104554199-104554221 CTTGTGCCTCAGGGAGTGTTTGG - Intronic
1126115686 15:45205418-45205440 CCTGTTCCACAGGGATTCTCTGG + Intergenic
1127314383 15:57781170-57781192 TCTGTGCCACAGGGTGTGTTAGG + Intronic
1127353986 15:58180681-58180703 ACTGTTCCCCAGGGCATTTTTGG + Intronic
1128183488 15:65624990-65625012 ACTGTTCCCTGGGGAGTCTTCGG - Exonic
1128379093 15:67098554-67098576 GCTGTTCGCCAGGGAGTGACAGG - Intronic
1131119250 15:89812960-89812982 CTTGTTAGCCAGGGAGTGCTGGG + Intronic
1132400467 15:101501960-101501982 CCTGGTCACCAGGGAGTCCTCGG - Intronic
1132674059 16:1114453-1114475 CGTCTTCCACAGGGAGAGTTTGG - Intergenic
1133317385 16:4893118-4893140 TCTTTTCCCCATGGAGTCTTGGG - Intronic
1133666276 16:7971286-7971308 CCTTTTGCCCTGGGTGTGTTTGG + Intergenic
1133970947 16:10567656-10567678 CCTTTTCCTCAGGGGGTCTTAGG - Intronic
1134136827 16:11682214-11682236 GCTGGTCCCAAGCGAGTGTTTGG - Intronic
1139459473 16:67110198-67110220 CTCGTTCCCCAGAGAGCGTTCGG - Exonic
1140062194 16:71580492-71580514 GCCGTCCCCCAGGGAATGTTTGG - Intergenic
1145777408 17:27539024-27539046 CCTGTTCCCTAGGGAGACTCTGG - Intronic
1146798563 17:35800321-35800343 CCTCCTCCCCAGGAAGTGTGTGG + Intronic
1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG + Exonic
1147387901 17:40092422-40092444 TCTCTTCCCCAGGGAGGGGTGGG + Intronic
1147795834 17:43042148-43042170 CCTGCTGCCCAGGGAATGTGGGG - Intergenic
1148209719 17:45800825-45800847 CCTGTTCCCCAGGAACTTGTAGG + Intronic
1148914307 17:50961517-50961539 CCTGTTCCCCAGGGACTAAGGGG + Intergenic
1148992730 17:51680568-51680590 CCTGTTCCCCAGGGAGTGTTTGG + Intronic
1150827591 17:68490501-68490523 CCTCCTGCACAGGGAGTGTTGGG + Intergenic
1152204832 17:78969024-78969046 CCTGTTCCCCCGGGACAGTCAGG - Intergenic
1152277223 17:79364900-79364922 CCTGGTGCCCAGGGAGTGGCTGG + Intronic
1152460786 17:80441364-80441386 TCTGCTCCCCAGGGGGTCTTGGG - Intergenic
1157054269 18:44207995-44208017 GTTATTCCCCAGCGAGTGTTTGG - Intergenic
1157859973 18:51132788-51132810 CCTGTTTCCCAGGGTGTCTGGGG - Intergenic
1158548573 18:58416271-58416293 CCTGTCCCCCAGGGTGGGGTGGG + Intergenic
1160433303 18:78827144-78827166 GCTGTCCCCCTGGGAATGTTTGG + Intergenic
1160819946 19:1053260-1053282 CCTCTTCCCCAGGGAGACTGGGG + Intronic
1161736997 19:5997432-5997454 CCTGTTCCCCAGGTGGTCTCTGG - Intronic
1162933699 19:13969952-13969974 CCAATTCCCCAGGGACTGCTGGG + Intronic
1163550509 19:17964191-17964213 CCTGGGCCCCAGTGAGTGTCAGG - Intronic
1164243439 19:23409947-23409969 TCTGTCACCCAGGGAGTGATGGG - Intergenic
1164274255 19:23702821-23702843 TCAGTTCCTCAGGGAGTGGTGGG - Intergenic
1167419318 19:49393997-49394019 CCTGGTCCCCAGGGTGGGCTGGG + Intronic
1167835141 19:52061971-52061993 GGTGTTCCCCACTGAGTGTTTGG - Intronic
927205140 2:20604215-20604237 CCTGTTCCCCATGGAGCCTAGGG + Intronic
930538923 2:52680488-52680510 CCTGTTCCTCAGGGATTGGTGGG + Intergenic
930664431 2:54088186-54088208 CCTGTATTCCAGAGAGTGTTAGG + Intronic
936291597 2:111228479-111228501 CCAGCTCCCCAGGTAGTGTCAGG + Intergenic
940990284 2:160089073-160089095 CCTGTTCCCCAAGTCTTGTTAGG + Intergenic
947520140 2:230839109-230839131 CCAGCTCCCCAAGGACTGTTGGG + Intergenic
947711862 2:232321100-232321122 TCTGTTCCCAAGGGACTCTTTGG - Intronic
948268560 2:236656689-236656711 CCTGTTCCCATGAGAGGGTTGGG + Intergenic
948652822 2:239459156-239459178 CCTGTACCCCAGGGTGGGTGAGG - Intergenic
948903165 2:240966238-240966260 CCTGTTGCCCAGGGAGAGCCTGG - Intronic
1174487540 20:50870858-50870880 CCTCTGCCACAGGGAGTGCTGGG - Intronic
1175479688 20:59302155-59302177 CCTGGTCTCCAGGGAGTCTAAGG + Intronic
1176421639 21:6520761-6520783 CCTGTAACAGAGGGAGTGTTGGG - Intergenic
1179149857 21:38800638-38800660 CCTGCTCCCAAGGTAGGGTTGGG - Intergenic
1179697129 21:43129077-43129099 CCTGTAACAGAGGGAGTGTTGGG - Intergenic
1179973047 21:44846977-44846999 CCTGTTCCCCAGCGAATGCATGG + Intergenic
1180713273 22:17854509-17854531 CCTGTTCACCAGGCAGTTCTCGG - Intronic
1181037060 22:20174777-20174799 CCTGTTTCCCAGGGAGCTGTTGG + Intergenic
1181335320 22:22124541-22124563 TCTGTGCCCCAGGGAGGGTTGGG + Intergenic
1181674211 22:24441362-24441384 CGTGTTCCCCTGGGACTCTTGGG - Exonic
1184131005 22:42516296-42516318 CCTGTTCCCCAGGGACAATATGG + Intronic
1184141175 22:42578121-42578143 CCTGTTCCCCAGGGACAATATGG + Intergenic
1184597662 22:45524139-45524161 CCAGTCCCCCAGGGAAGGTTGGG + Intronic
949312361 3:2714135-2714157 CCTGTTGGCCAGGCAGTGTTGGG + Intronic
950093711 3:10315702-10315724 CCTGTTCCGCAGGGTGGGTATGG + Intronic
950502873 3:13375714-13375736 CCCGATCCCCAGGGAGGGGTGGG - Intronic
950981008 3:17304308-17304330 CCTGTTCCCCAGTGAGAGACAGG - Intronic
954692729 3:52404278-52404300 CCAGGTCCCCAGGAAGTTTTTGG - Intronic
955948712 3:64220748-64220770 TCTGTGCCCCCTGGAGTGTTAGG + Intronic
956722649 3:72132164-72132186 CCTTTTCCCAAGGGTGTTTTGGG - Intergenic
957554178 3:81745118-81745140 CCTGTGCCAAAGAGAGTGTTAGG + Intronic
958885769 3:99725228-99725250 CCTGCTGTCCAGGGAGAGTTCGG - Intronic
959836024 3:110919075-110919097 ACTATTCCTCAGGGAGTGTTGGG - Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961781470 3:129323254-129323276 CCTGATCCCCAGGGAGGGGTGGG - Intergenic
962268023 3:133957265-133957287 CCTCTCCCCCGTGGAGTGTTGGG + Intronic
964119109 3:153163408-153163430 CCTGTGCCCGAGGGGGTGTCCGG + Exonic
964905107 3:161709937-161709959 CCTGTTCCCCAGTGACTACTGGG + Intergenic
967191833 3:186991437-186991459 CCTGATCCCCAGTGTGAGTTAGG - Intronic
967555253 3:190849348-190849370 CCTGGCCCACAGGGAGTCTTGGG - Intergenic
974883235 4:67784988-67785010 CCTGTACCCTTGGGAGTTTTGGG + Intergenic
975732402 4:77350478-77350500 GCCCTTCTCCAGGGAGTGTTGGG + Intronic
976804418 4:89029943-89029965 CCTGTTAACCAGGTAGTGCTGGG - Intronic
979209053 4:118077801-118077823 CATGTTCCCCAGGAAGTACTTGG - Intronic
982343655 4:154332576-154332598 CCTGTTCCCCAAGGGGTAATAGG - Exonic
983488647 4:168362001-168362023 CCTTTTCCCCAGTGGGTGGTGGG - Intronic
985683336 5:1268488-1268510 CCTCTTCCCCAGGGGGGCTTGGG - Intronic
985959177 5:3286805-3286827 CCTGTTTACCAGGGAGTGCTGGG - Intergenic
986079761 5:4378075-4378097 TCAGTTCCCCAGGGAAAGTTGGG + Intergenic
988776215 5:34480108-34480130 CCTGCTCCCCAGGGAGGGTGGGG + Intergenic
990697691 5:58439305-58439327 GCTGTACCTCAGGGACTGTTTGG - Intergenic
994401437 5:99285239-99285261 CCTGTGCCCCAGGGAAAATTAGG + Intergenic
995027654 5:107443032-107443054 CCTGTACCCCAGGGAAAATTTGG - Intronic
996004891 5:118407789-118407811 CCAGTTCCAAGGGGAGTGTTTGG + Intergenic
997206923 5:132055646-132055668 AGTGTTCCCTAGGGAGTGCTGGG - Intergenic
997472444 5:134124425-134124447 CCAGTTCCCCAGGGAGTAGAGGG + Intronic
997528279 5:134567296-134567318 CTTCTCCTCCAGGGAGTGTTGGG - Intronic
997846271 5:137288752-137288774 CCTGTTCCCCTGGTACAGTTAGG - Intronic
998091094 5:139370148-139370170 CCTGTACCCCAGTGTGTGGTTGG + Intronic
1000105484 5:158055115-158055137 ACTGTTCCCCAGCTAGAGTTAGG - Intergenic
1000295263 5:159908101-159908123 AAGGTTCCCCAGGAAGTGTTAGG + Intergenic
1001115263 5:168934073-168934095 CATGTTCCTTAGGGAGTGATGGG + Intronic
1001980552 5:176034902-176034924 CCTGCTCCCCAGGGAGTGTTGGG - Intergenic
1002236909 5:177809163-177809185 CCTGCTCCCCAGGGAGTGTCGGG + Intergenic
1002804184 6:556435-556457 CCAGTTTCCCAGGGAGCCTTGGG - Intronic
1004449008 6:15727370-15727392 ACTGATCCCCAGTGTGTGTTGGG - Intergenic
1005646301 6:27841709-27841731 CCTGATTCCCAGGAAGTGCTTGG + Intronic
1006337952 6:33430872-33430894 CCTGTTCCTGAGGGAGTGATAGG + Intronic
1006621577 6:35368443-35368465 CATATTCACCAGGGAGTTTTGGG + Intronic
1007339606 6:41182116-41182138 CCTGTTCCCCAGGATCTGCTAGG - Intergenic
1009785315 6:68330069-68330091 CCTGTTATCCAGGGATTGTCAGG + Intergenic
1011045342 6:83075752-83075774 CCTCTTCACCAGATAGTGTTGGG + Intronic
1014049966 6:116940458-116940480 GATGTTCCCCAGGGAGTATATGG + Intergenic
1014758543 6:125328985-125329007 CCTGTTCCCAAGTGAATATTAGG + Intergenic
1017635493 6:156439284-156439306 TTTGTTCCCCAGGGAGGGTTGGG - Intergenic
1019696751 7:2450590-2450612 CCTGTTCCCCAGGGAGTGGGGGG - Intergenic
1019985366 7:4651500-4651522 CCTGGTCCCCAGGGGCTGTGAGG - Intergenic
1022063524 7:26826024-26826046 CCTGATCCCCATGGAGATTTGGG - Intronic
1022401854 7:30046238-30046260 ACTGTTCCCCAGGGATTATCAGG - Exonic
1022833555 7:34092349-34092371 TCTGTCCCTCAGGTAGTGTTTGG + Intronic
1024045832 7:45584964-45584986 TCTGTTCCCCAGGGAGCATGTGG + Intronic
1026476893 7:70744092-70744114 CCTGTTTCCCAGGAACTTTTTGG - Intronic
1026995373 7:74612550-74612572 CCTGTCCCCCAGGGAGCCTTGGG + Intergenic
1028510546 7:91620718-91620740 CCTGTGACGCAGGGAGTGGTGGG - Intergenic
1035003503 7:155637028-155637050 CCTCTTACACAGGGAGTGTCTGG + Intronic
1035461529 7:159041951-159041973 CCCGTTCCCCAGGTGGAGTTGGG - Intronic
1035633793 8:1128209-1128231 CCTGCTCCCCATGTTGTGTTCGG + Intergenic
1036183704 8:6606532-6606554 CCTGTCGACCAGGGAGTGTCAGG + Intronic
1036287534 8:7457049-7457071 CATGTTACCCAGGGAGACTTTGG - Intronic
1036333946 8:7854476-7854498 CATGTTACCCAGGGAGATTTTGG + Intronic
1039115491 8:34087655-34087677 TAAGTTCCCCAGGGAGTGGTGGG - Intergenic
1044531270 8:93310249-93310271 CCTTTGTGCCAGGGAGTGTTAGG - Intergenic
1046112811 8:109747016-109747038 CCTGTTTCTCAGCGGGTGTTAGG - Intergenic
1047752750 8:127894217-127894239 CCTGTTCCCCACGGGGTGCCTGG + Intergenic
1048776369 8:137951130-137951152 ACTGTTCTCCAGGGAAAGTTTGG - Intergenic
1050601933 9:7261721-7261743 CCTGTTCCACAGGGACTAGTAGG - Intergenic
1056214421 9:84393909-84393931 CCAGTTCCCCAGGGAAGGCTTGG + Intergenic
1057726032 9:97568799-97568821 CCTGTTCCCCTAGGTGTCTTAGG + Intronic
1057928440 9:99172656-99172678 CCAGTGACCCAGGGACTGTTTGG + Intergenic
1059241093 9:112806212-112806234 CCTGTCCCCCAGGGAACATTTGG - Intronic
1059302069 9:113321898-113321920 CCTGATCCCCATGAGGTGTTGGG - Intronic
1060907899 9:127324389-127324411 GCTCTTCCCCAGAGAGTCTTGGG + Intronic
1061130086 9:128703592-128703614 CCTGTTCCGGAGCGAGTGGTTGG + Intronic
1061373129 9:130209054-130209076 CCAGGTCTCCAGGGAGTGTGGGG + Intronic
1062380019 9:136282627-136282649 CCTGTGGCCCAGGGGTTGTTAGG + Intronic
1062568932 9:137175625-137175647 GCTGTTCCCCAGTGAGGGTGTGG - Intronic
1062733866 9:138123976-138123998 CCATTTCCCCAGGCAGTGTTGGG + Exonic
1190259008 X:48786487-48786509 CCTCCTCCCCAGGGAGTGGCTGG - Intergenic
1190998731 X:55637295-55637317 CCTGCTCCCCAGGGACAGTGGGG - Intergenic
1197729621 X:129798605-129798627 CCAGGTCCCCAGGAGGTGTTGGG + Intergenic
1200957941 Y:8970368-8970390 CCTGTGCACCAGAGAGTGTCTGG - Intergenic
1201352515 Y:13059760-13059782 CCTGTTCCTGAGTGACTGTTGGG - Intergenic