ID: 1148997495

View in Genome Browser
Species Human (GRCh38)
Location 17:51723903-51723925
Sequence CTGGGTGCCCATGGGGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 2, 1: 0, 2: 3, 3: 19, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148997484_1148997495 27 Left 1148997484 17:51723853-51723875 CCTTGCACTCATTAGCTGGGGCA 0: 1
1: 0
2: 0
3: 18
4: 112
Right 1148997495 17:51723903-51723925 CTGGGTGCCCATGGGGTACCTGG 0: 2
1: 0
2: 3
3: 19
4: 243
1148997489_1148997495 -9 Left 1148997489 17:51723889-51723911 CCAGCCCATGTTTACTGGGTGCC 0: 1
1: 0
2: 1
3: 13
4: 122
Right 1148997495 17:51723903-51723925 CTGGGTGCCCATGGGGTACCTGG 0: 2
1: 0
2: 3
3: 19
4: 243
1148997485_1148997495 4 Left 1148997485 17:51723876-51723898 CCACTGCAGCCAGCCAGCCCATG 0: 1
1: 1
2: 9
3: 103
4: 813
Right 1148997495 17:51723903-51723925 CTGGGTGCCCATGGGGTACCTGG 0: 2
1: 0
2: 3
3: 19
4: 243
1148997487_1148997495 -5 Left 1148997487 17:51723885-51723907 CCAGCCAGCCCATGTTTACTGGG 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1148997495 17:51723903-51723925 CTGGGTGCCCATGGGGTACCTGG 0: 2
1: 0
2: 3
3: 19
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148997495 Original CRISPR CTGGGTGCCCATGGGGTACC TGG Intronic
900389110 1:2426466-2426488 CTGAGTCCCCATGGGGTCCTGGG + Intronic
900409799 1:2507416-2507438 GTGAGGGCCCATGGGGTTCCGGG + Intergenic
900524397 1:3121470-3121492 CTGGGGGCCTCTGGGCTACCTGG - Intronic
900796694 1:4712416-4712438 CTGGGGGCCCACGGGGGACGAGG + Exonic
901238135 1:7678491-7678513 GTGGTTCCCCTTGGGGTACCAGG + Intronic
902328115 1:15716011-15716033 CTGGGTGCCTCTGGGGGACTGGG + Intronic
902368991 1:15993799-15993821 CGGGGTCCCCATGGGCTTCCTGG - Intergenic
902615313 1:17620490-17620512 CTGGGTGCCACTTGAGTACCTGG + Intronic
902991371 1:20189575-20189597 CAGGGTGCCTATCGGGTAGCTGG + Intronic
903305216 1:22408438-22408460 CTGGCTGCCCTTGGGGCTCCGGG + Intergenic
905014966 1:34771605-34771627 CTTGGGGCCCCAGGGGTACCTGG - Intronic
905169087 1:36099136-36099158 CCAGGTGCCCAAGGGGTGCCAGG - Exonic
905395196 1:37662305-37662327 CTGGCTGCCCACTGGGCACCTGG - Intergenic
905899998 1:41575112-41575134 CTGGTTTCCCATGGGGCACTTGG - Intronic
905974330 1:42164171-42164193 CAGGGTGTCCATGTGGTTCCTGG + Intronic
906028181 1:42693386-42693408 CTGGCTGCCAATTAGGTACCAGG - Intronic
906512832 1:46420863-46420885 CTGGGTACCCACTGAGTACCAGG - Intergenic
906727541 1:48054951-48054973 ATGGGTGCCCGTGGGGGAACTGG + Intergenic
907287328 1:53390256-53390278 CTGGGTGCCCCTGGGCATCCTGG + Intergenic
907287554 1:53391494-53391516 CTGGGTGCCCCTGGGCATCCTGG - Intergenic
907400440 1:54221917-54221939 CTGGGAGCTCCTGGGGTACTGGG + Intronic
908320942 1:62978288-62978310 CTGGCTGTCCAGGGGGAACCAGG + Intergenic
910425306 1:87115218-87115240 CTGGGTGCCCATGTTGGATCTGG - Intronic
912822772 1:112881070-112881092 CTGGATGCCCAAGGGGAGCCGGG + Intergenic
920048013 1:203146059-203146081 CTGGGAGCCCAGGGGCTGCCTGG + Intronic
922016692 1:221655438-221655460 CTGAGTGGCCATGGCTTACCTGG - Intergenic
922772227 1:228192095-228192117 CTGGGGGCCCATAGGGTGCTGGG + Intergenic
923292427 1:232559169-232559191 CTGCCAGCCCATGGGGTAGCAGG + Intronic
1063968897 10:11367732-11367754 CTCGGTGCCCACAGGGCACCAGG + Intergenic
1065185462 10:23166278-23166300 CTTGGGGCCCATGGGGTTCGTGG - Intergenic
1069923578 10:71832636-71832658 TTGGGTGTCCATGGGGGTCCTGG - Intronic
1069960195 10:72074970-72074992 CTGGGAGCCTGTGGGGCACCTGG + Intronic
1070741713 10:78907654-78907676 CTGGATGTGCATGGGGTGCCCGG - Intergenic
1073443646 10:103568132-103568154 CTGGGTGCACATGGTGCCCCTGG + Intronic
1075438223 10:122460624-122460646 CTGGGTGCCCAGGCAGCACCAGG - Intergenic
1076734435 10:132452404-132452426 CTGGGTGCCCACGCTGTACCCGG + Intergenic
1076943337 10:133625246-133625268 CTGGGTGGCCATGGAATACAAGG + Exonic
1077012643 11:385732-385754 CTGGGTGCTCACGGGCTCCCGGG - Intergenic
1083581272 11:63827021-63827043 CTTGGTGCCCTGGGGGTGCCTGG - Exonic
1083781714 11:64921726-64921748 CTGGCTGCCCCTGAGCTACCTGG - Intronic
1083891230 11:65596698-65596720 CTGGGCTGCCATGGGGCACCTGG + Intronic
1084195394 11:67521656-67521678 CTGGGTGCCCACTGTGTGCCTGG - Intronic
1084363500 11:68684017-68684039 CTGGGAGGTCATGGGGTACCCGG - Intronic
1084680940 11:70665997-70666019 CTGGGCACACATGGGGCACCTGG - Intronic
1084709665 11:70836122-70836144 CTGCTTGCCCATGGGGGGCCAGG + Intronic
1084802736 11:71555478-71555500 CTGGGTGCCCATGGCACCCCTGG - Intronic
1084901862 11:72315736-72315758 CATGGTACCCATGGGGTGCCAGG + Intronic
1085354471 11:75823108-75823130 CTGGGTGCCATAGGGGTACTAGG - Intronic
1089289608 11:117429736-117429758 CAGGGTGCCCATGGAGCACGGGG - Intronic
1089715378 11:120353987-120354009 CTGGGACCCCATGGGGTTCTGGG - Intronic
1090854966 11:130603095-130603117 CTGGCTGCCTTTGGGGTACGTGG + Intergenic
1091695410 12:2625011-2625033 CAGAGTGCCCACGGGGCACCGGG + Intronic
1092159756 12:6310024-6310046 CTGGGTGACCCTGGTGTAGCCGG + Intergenic
1095309229 12:40677690-40677712 CTGACTGCCCATTGTGTACCTGG - Intergenic
1101481906 12:105106577-105106599 TTGAGTGCCCACTGGGTACCAGG - Intergenic
1102237575 12:111303933-111303955 CTGGGTTCTCGTGGGGTGCCTGG - Intronic
1103925848 12:124423036-124423058 CTGAGTGCCCGTGGGGCAGCAGG + Intronic
1106035166 13:26037612-26037634 CTGTGTCCCCGTGGGGCACCAGG + Intergenic
1106578539 13:30998575-30998597 CTGGGTTGCCATGGGCAACCAGG + Intergenic
1108075105 13:46671399-46671421 CTGGGTGCCTATCAGGTGCCAGG - Intronic
1112398489 13:99055332-99055354 CTGTGTCCCCATGCGGTAGCAGG + Intronic
1113883909 13:113647330-113647352 CTGGGTGGCCATGGGACACGTGG + Intergenic
1115741102 14:36389886-36389908 ATGGGAGCACATGAGGTACCAGG - Intergenic
1119160559 14:72448984-72449006 CTGAGTGCCCATGGTGTACCAGG - Intronic
1122243224 14:100382927-100382949 CTGAGCGCCTATGAGGTACCTGG - Intronic
1122860115 14:104578773-104578795 CTGGGAGCCCAGGGTGTGCCAGG - Intronic
1123062027 14:105598744-105598766 CTTTGTGCTCATGGGGTGCCCGG + Intergenic
1123086770 14:105720475-105720497 CTTTGTGCTCATGGGGTGCCCGG + Intergenic
1127161558 15:56192515-56192537 AAGTGAGCCCATGGGGTACCTGG + Intronic
1128160173 15:65418502-65418524 TTGGGGGCCCATGGGGTCCTTGG - Intronic
1128708637 15:69855778-69855800 CTGGGTCTCCCTGGGGAACCAGG - Intergenic
1132568519 16:634159-634181 CTGGCTGGGCATGGGGCACCTGG - Intergenic
1132626633 16:894493-894515 CTGAGTGCCCTTGAGGTGCCGGG + Intronic
1132663372 16:1071236-1071258 CTGGGTGCCCCAGGGGTGCAGGG - Intergenic
1134165518 16:11926336-11926358 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1134500556 16:14766348-14766370 CAGGGTGCCCAGGGGATACTCGG + Intronic
1134527096 16:14952961-14952983 CAGGGTGCCCAGGGGATACTCGG + Intergenic
1134545307 16:15103387-15103409 CAGGGTGCCCAGGGGATACTCGG - Intronic
1134580027 16:15362702-15362724 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1134714681 16:16351494-16351516 CAGGGTGCCCAGGGGATACTCGG + Intergenic
1134722558 16:16394858-16394880 CAGGGTGCCCAGGGGATACTCGG + Intergenic
1134944870 16:18317011-18317033 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1134952134 16:18357164-18357186 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1135363422 16:21833654-21833676 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1136150058 16:28341575-28341597 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1136166293 16:28455390-28455412 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1136196680 16:28659642-28659664 CAGGGTGCCCAGGGGATACTCGG + Intergenic
1136213020 16:28773767-28773789 CAGGGTGCCCAGGGGATACTCGG + Intergenic
1136257746 16:29053680-29053702 CAGGGTGCCCAGGGGATACTCGG + Intergenic
1136307221 16:29380380-29380402 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1136320746 16:29482623-29482645 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1136435319 16:30221963-30221985 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1136716923 16:32288859-32288881 TCGGGTGCCCCTGGGGGACCTGG + Intergenic
1136835298 16:33495104-33495126 TCGGGTGCCCCTGGGGGACCTGG + Intergenic
1137557668 16:49482957-49482979 CAGGGTGGCCAGGGGGCACCTGG + Intergenic
1137613708 16:49835174-49835196 CTGGGGGCCCATGGGGTGTGGGG - Intronic
1138187574 16:54988135-54988157 CTGAGTGCCCATTATGTACCAGG + Intergenic
1138595614 16:58027532-58027554 CTTGGTGCCCTTGGGCTGCCCGG + Intronic
1139576128 16:67843216-67843238 CTGGGGGCCCATAGGGCACTCGG - Exonic
1139599754 16:67979620-67979642 CTGTGTGTCCCTGTGGTACCTGG + Exonic
1139973883 16:70793558-70793580 CTGGGTGCCCACTGTGTGCCAGG + Intronic
1140217369 16:73019398-73019420 CTGAGTGCACATGGGCTGCCTGG + Intronic
1142144345 16:88486617-88486639 CTGGGTGCACAGTGGGTACTAGG + Intronic
1142242354 16:88953365-88953387 CTGGGTGGACATGGGGAGCCTGG - Intronic
1203009505 16_KI270728v1_random:228928-228950 TCGGGTGCCCCTGGGGGACCTGG - Intergenic
1203145471 16_KI270728v1_random:1795425-1795447 TCGGGTGCCCCTGGGGGACCTGG + Intergenic
1142981740 17:3676394-3676416 CTGGCTGCCTCTGGGGAACCGGG + Intronic
1143556959 17:7667996-7668018 CTGGGTTCCCAAGGGGAACAGGG - Intronic
1143781363 17:9231275-9231297 CTGAGATACCATGGGGTACCCGG + Intronic
1144756137 17:17681709-17681731 CTGGGTGGCCATGGGGGTCGGGG - Exonic
1144851611 17:18246803-18246825 CTGGGTGCCTGTGGAGTACGAGG - Exonic
1144856446 17:18270993-18271015 CTGAGAGCCCATGGGGTAACTGG - Intergenic
1144998647 17:19288281-19288303 TTGAGTTCCCATGGGGCACCAGG + Intronic
1146621474 17:34401845-34401867 CTGAGTGCCCAGTGGGTGCCAGG - Intergenic
1147652267 17:42069354-42069376 CTGGGTTTCCATGGGGTCCTTGG + Intergenic
1148215617 17:45832728-45832750 CTGGGTGCCCACTGGGTGACAGG + Intronic
1148783645 17:50134915-50134937 CTCCCTGCCCATGGGGCACCTGG - Exonic
1148997495 17:51723903-51723925 CTGGGTGCCCATGGGGTACCTGG + Intronic
1149526135 17:57357309-57357331 CTGGGTGGCCTTGGGGGTCCTGG - Intronic
1151818249 17:76482297-76482319 CTGGGTGGCCTTGGGGGACAGGG - Intronic
1152011957 17:77724309-77724331 CTGGGTTCCCAAGGGCTTCCTGG + Intergenic
1152223882 17:79083777-79083799 CTGGGCGCTCAGGTGGTACCAGG - Exonic
1152436287 17:80278334-80278356 CTGGCTGGCCCTGGGGTGCCCGG + Intronic
1153895675 18:9556892-9556914 TTGGGTGTGCATGGGGGACCTGG + Intronic
1154116773 18:11618345-11618367 CAGGGTGCCCAGGGGATACTCGG - Intergenic
1155359269 18:24983832-24983854 CTGGGTTACCATGGGGGACATGG - Intergenic
1157006646 18:43590536-43590558 CTGGGTGCTCGTGGGCTCCCAGG + Intergenic
1157111196 18:44821836-44821858 CTGGGTCTCCTTGGTGTACCTGG + Intronic
1157298076 18:46460047-46460069 CTGGGTGCCGAAGGGGGTCCTGG - Exonic
1158006646 18:52680110-52680132 CTGGGTGCCCATTGGGTTCTTGG + Intronic
1161317437 19:3624227-3624249 CTGGGTGCCCGTGGGGGAGCAGG + Intronic
1161446457 19:4321840-4321862 CTGGGTCCCCAAGGAGTATCTGG + Intronic
1161592159 19:5133758-5133780 CTGGCTGCCCACAGGGTCCCTGG - Intronic
1161616643 19:5274521-5274543 CTGGGTGCCCATGGGTGCCGTGG - Intronic
1162153226 19:8659989-8660011 CTGGGTGCTCATGAGGCCCCAGG - Intergenic
1163318176 19:16555644-16555666 CTTGGTGCCCTTTGGGGACCTGG - Intronic
1163347001 19:16749650-16749672 CTGGGGGCCCAAAGAGTACCAGG - Exonic
1163648976 19:18506109-18506131 CTGGGTGCCCATGTGTGCCCAGG + Intronic
1164426699 19:28148001-28148023 ATGGGTACACATGGGGAACCAGG - Intergenic
1164596477 19:29533684-29533706 CTGGGTGGCCTTGGGTGACCGGG - Intronic
1164761648 19:30732817-30732839 ATGGTTACCCATGGGGTACAGGG - Intergenic
1165423616 19:35733814-35733836 CTGGGGGACCATCGGGGACCTGG - Exonic
1165902428 19:39175005-39175027 CTGGGTGGTCATGGAGTTCCTGG + Exonic
1166230971 19:41425722-41425744 CTGGGTGGGCCTGGGGCACCAGG + Exonic
1167490740 19:49791640-49791662 CTGGGTGCCCATGGGGTACCAGG - Intronic
1167755553 19:51411129-51411151 CTGGGTGCCCTTGGGCATCCGGG + Exonic
1167869553 19:52356317-52356339 CTAGGTCCCCATGGGGAACATGG + Intronic
1168065287 19:53915711-53915733 CTGGGTGCTAATTAGGTACCAGG + Intronic
1168133928 19:54338036-54338058 CAGGGGGCCCATGGGGAACAGGG + Exonic
925920104 2:8632507-8632529 CTGTGAGCCCACTGGGTACCTGG - Intergenic
926003538 2:9353645-9353667 ATGGGTGACCATGGAGTGCCTGG - Intronic
926003615 2:9354119-9354141 CAGGGTGCCTATGGGGTTCGCGG - Intronic
927153102 2:20206835-20206857 GTGGGTGCCCACTGGGTGCCAGG - Intronic
931506915 2:62939029-62939051 CTGAGTGCCTATGCTGTACCAGG + Intronic
932054921 2:68433664-68433686 CTGGGTGCTCATGGGTTCCTGGG + Intergenic
934583733 2:95469554-95469576 CTGACTGACCATGGGGTATCAGG - Intergenic
934595719 2:95607160-95607182 CTGACTGACCATGGGGTATCAGG + Intergenic
934787056 2:97018329-97018351 CTGACTGACCATGGGGTATCAGG - Intronic
937066267 2:119020330-119020352 CTGAGTTCCCCTTGGGTACCTGG + Intergenic
937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG + Intronic
937909083 2:127066671-127066693 CAGGGTGCCCATGGGGAACCAGG - Intronic
940250095 2:151665473-151665495 CTGGGTGCCCATAGAGTCCCTGG - Exonic
944523903 2:200598972-200598994 CTGGATGCCCATGTGAGACCTGG + Intronic
945659633 2:212669626-212669648 CTGGGGGCCTATCGGGTATCAGG - Intergenic
946830694 2:223725528-223725550 CCGGGTGCCCTTGGGGTGCCTGG + Intergenic
947998484 2:234548162-234548184 GTGGGTGCCCCTGGGGAAACAGG - Intergenic
948682446 2:239645024-239645046 GTGGGTCCCCAAGGGGCACCAGG - Intergenic
1168995657 20:2130948-2130970 CTAGGTCCCCAGGGGGTTCCAGG - Intronic
1171148300 20:22804810-22804832 CTGCATGCCCATGTGGTACTTGG + Intergenic
1171780714 20:29415409-29415431 CTGGGTGGCCATGGAATACAAGG + Intergenic
1173704196 20:45098132-45098154 CTGGCTGACCATGGAGAACCCGG - Exonic
1174561440 20:51433272-51433294 CTGAGTGCCCATTAAGTACCAGG - Intronic
1175264855 20:57696303-57696325 CTGGGCGCCCCTGGGGCTCCAGG + Intronic
1175539451 20:59739146-59739168 CTGGGCTCCCACTGGGTACCAGG + Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175975387 20:62708264-62708286 CTGGGTGCCCAGGGGGCTCTAGG - Intergenic
1176130735 20:63495775-63495797 CTGGGGGCCCCTGGGGTCACTGG - Intronic
1177863051 21:26478041-26478063 CTGAGTGCCCATTATGTACCAGG + Intronic
1178526112 21:33330831-33330853 GTTGGTGCCCATGGTGTAGCTGG - Intronic
1181041519 22:20194787-20194809 CCGGGTGCCCATGTGGGGCCAGG - Intergenic
1181086299 22:20441020-20441042 CTGGGTGCCTAAGGGTTACCTGG + Intronic
1183185364 22:36288691-36288713 TTGGGCACCCATGGGGTAGCAGG + Intronic
1183464772 22:37973974-37973996 CTGGGTGCCCATTGGGCGGCAGG + Exonic
1184529983 22:45049201-45049223 TTGGGTGCCCTTGGGATACCCGG + Intergenic
1184998301 22:48226565-48226587 CTGGGTGGGCATGGTGCACCCGG - Intergenic
1184998339 22:48226749-48226771 CTGGGTGGGCATGGTGCACCTGG - Intergenic
1184998349 22:48226795-48226817 CTGGGTGGGCATGGTGCACCCGG - Intergenic
950105469 3:10385677-10385699 CTGGCTGCCCATTGGGGGCCAGG + Intronic
950162486 3:10771012-10771034 CTGGGTGCCCCAGGGGCCCCAGG + Intergenic
950304178 3:11905611-11905633 CTTGGTGGCCATGGGATTCCAGG + Intergenic
953212389 3:40887558-40887580 ATGGGTTCCCATGGTGTCCCTGG - Intergenic
953705547 3:45227217-45227239 CTTGGTGCTCATGGAGTACAAGG - Intergenic
955365160 3:58304520-58304542 TTGGGTCACCATTGGGTACCAGG + Intergenic
959256999 3:104028110-104028132 CTGGGAGCTCCTGGGGTACAGGG - Intergenic
961518811 3:127455422-127455444 CTGAGTGCCCCTTGGGTCCCTGG - Intergenic
962312784 3:134337868-134337890 CTGGGTGGCCTTTGAGTACCAGG - Intergenic
963474528 3:145788486-145788508 CTGTGAGCTCATGAGGTACCTGG + Intergenic
966878058 3:184334928-184334950 CTGTGTGTCCATGGGGCTCCAGG - Exonic
968511223 4:996792-996814 CTGAGTGCCCAGGGGGTCCAGGG + Intronic
969220425 4:5755275-5755297 CTGGGTGACCTTGGTGTCCCAGG + Intronic
969447689 4:7254907-7254929 CTGTGTTCCCATGAGGTCCCAGG + Intronic
969463617 4:7342161-7342183 CTGAGTGCCCACTGGGTGCCAGG + Intronic
969522489 4:7686694-7686716 GTGCCTGCCCATGGGGCACCAGG - Intronic
969702852 4:8777223-8777245 CTCAGTGCTCAGGGGGTACCCGG - Intergenic
970030877 4:11673366-11673388 CTGGGTGCCCATGTGTTCCCTGG - Intergenic
970147903 4:13056299-13056321 CTCAGCCCCCATGGGGTACCTGG - Intergenic
970535578 4:17026887-17026909 CTGGGTGCCCGCTGGGTGCCAGG + Intergenic
972046443 4:34670703-34670725 TTGGGGGCCCAGGGGGTACTGGG + Intergenic
977696453 4:99971576-99971598 GTGGGTCCCCAGGAGGTACCTGG - Intergenic
978711506 4:111788184-111788206 ATGGGTGCGGATGGGGGACCTGG + Intergenic
981616297 4:146647983-146648005 CTGGGGGCCCCTCGGGGACCGGG - Intergenic
985446693 4:190025708-190025730 CTGGGTGGCCATGGAATACAAGG + Exonic
986333655 5:6736687-6736709 CTTGGAGCCCATGGGGTGACAGG + Intronic
986583330 5:9288361-9288383 CTGGCTGCCACTGGGTTACCTGG - Intronic
991586698 5:68209341-68209363 CTGAGTGCCCATGATGTACCAGG + Intergenic
992091039 5:73317206-73317228 CTAGGTGCCCATGGGAGACCTGG - Intergenic
999980873 5:156956776-156956798 CTGGGTACCCAAGGGGGAGCAGG - Intronic
1002080068 5:176732494-176732516 GTGGGGGCCCATGGAGTAGCAGG + Intergenic
1002306454 5:178286622-178286644 CTGGGTGCGGATGGAGTAGCTGG - Intronic
1002897469 6:1388099-1388121 CTGTGTGCCCCTGGAGTGCCGGG - Intergenic
1005561481 6:27045564-27045586 CTGGGTGCCCGTGGAGTAGGGGG - Intergenic
1006706307 6:36024384-36024406 CTGAGTGCCCACGGCGTGCCTGG + Intronic
1011698253 6:89932583-89932605 CTGGGTGCCCAGGGGGGTCCGGG + Exonic
1012338663 6:98091337-98091359 CTGGTTGCCCATGGAGTCTCAGG - Intergenic
1014579589 6:123120649-123120671 CTATGTGCCCATGGGGTACCTGG - Intergenic
1016741263 6:147531509-147531531 CTGGGTGCCCGCCAGGTACCAGG - Intronic
1017951898 6:159142105-159142127 CCAGCAGCCCATGGGGTACCTGG - Intergenic
1019517935 7:1447855-1447877 CTTGGTGCCCGGGGGGGACCTGG + Intronic
1024548290 7:50540094-50540116 CTGGGAGCCATGGGGGTACCTGG - Intronic
1025234274 7:57223314-57223336 CTGGGTGCCCCCCGGGTGCCTGG + Intergenic
1026591958 7:71704153-71704175 CAGAGTGACCATGAGGTACCTGG + Intronic
1027858135 7:83539199-83539221 CTGGGAGCCCAGGGGGAAGCTGG + Intronic
1029668888 7:102014923-102014945 CTGGCTGCACATGGGTTACCAGG + Intronic
1032409759 7:131686342-131686364 CTGGGTGCCCATCATGTGCCAGG + Intergenic
1032475485 7:132208811-132208833 TGGTGTCCCCATGGGGTACCTGG - Intronic
1035272386 7:157728077-157728099 CTGGGTACCCACCGGGTACCAGG - Intronic
1035372303 7:158387216-158387238 CTGGTCTCCCATGTGGTACCAGG - Intronic
1036153471 8:6320274-6320296 CTGGGTTCCCATGGAGTCCTGGG + Intergenic
1036270850 8:7301514-7301536 CTGAGTCCCCATGGGGGATCAGG - Intergenic
1036350500 8:8008830-8008852 CTGAGTCCCCATGGGGGATCAGG + Intergenic
1036627883 8:10486866-10486888 CTCGGTGCCCATGGGATTCACGG + Intergenic
1039146882 8:34457217-34457239 CTGGGTGCTTATGATGTACCAGG - Intergenic
1039484706 8:37901291-37901313 CTGGGTGCACAGTAGGTACCCGG + Intergenic
1040436093 8:47393156-47393178 TTGTGTGCCTATGGGATACCTGG - Intronic
1044529852 8:93294553-93294575 CTGAGTACCTATGGTGTACCAGG + Intergenic
1044710205 8:95049895-95049917 CTGAGTGCCCATAATGTACCAGG - Intronic
1046407322 8:113791084-113791106 ATGGGTGGCCATGGTGGACCGGG + Intergenic
1048502384 8:134990196-134990218 CTGGGTGCCCATCAGGTTCCTGG + Intergenic
1048581062 8:135730185-135730207 CTGGGAGCCGATGGGGTTACCGG + Intergenic
1049443749 8:142620663-142620685 CTGGGTGCACATGGGGAGACAGG + Intergenic
1049526351 8:143128600-143128622 CTGGGTGCCTATGGCCTATCAGG + Intergenic
1049604169 8:143521388-143521410 GGGGCTGCCCATGGGGCACCAGG - Intronic
1049696080 8:143984930-143984952 CTCGATGCCCATGGGGTCTCTGG - Exonic
1052017412 9:23485097-23485119 CTGGGTGCCCCTGGGCAACCAGG + Intergenic
1052740912 9:32392418-32392440 CTGAGTGCCTGTGGGGTGCCAGG - Intronic
1053015443 9:34659398-34659420 CTGCCTGCCTGTGGGGTACCTGG + Intronic
1054946994 9:70806072-70806094 CTGGGTTCACATGGGGTACTGGG - Intronic
1056679517 9:88704949-88704971 CTGGGGGCCCATGGGTGAGCTGG + Intergenic
1058716355 9:107725771-107725793 TTGTGTGCCCATGAGGTGCCAGG + Intergenic
1059418763 9:114178288-114178310 CAGGGTCCCCCTGGGCTACCTGG + Exonic
1061847348 9:133395130-133395152 CTGGGAGACCATGGGGAACCTGG - Intronic
1062120943 9:134833774-134833796 CTGGGTGCCCAGGATGTACAAGG - Intronic
1185737231 X:2502736-2502758 CTGGGGTCCCCTGGGGGACCAGG - Intronic
1186316642 X:8377977-8377999 CTGGGTGCCCATGATGTGCATGG + Intergenic
1190109277 X:47579509-47579531 GTGGGGGCCCATGGGGGTCCAGG - Intronic
1194971772 X:100351882-100351904 TTTGGTGCCCATGTGGTAGCTGG - Intronic
1197566810 X:128098380-128098402 CCTGGTGTCCATGGGGTATCTGG - Intergenic