ID: 1148999083

View in Genome Browser
Species Human (GRCh38)
Location 17:51738637-51738659
Sequence AGCCATGATGAGCATCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148999083_1148999086 21 Left 1148999083 17:51738637-51738659 CCTTGTGGATGCTCATCATGGCT 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1148999086 17:51738681-51738703 CCAATGTCTTTGCTGTTTTGAGG 0: 1
1: 0
2: 2
3: 27
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148999083 Original CRISPR AGCCATGATGAGCATCCACA AGG (reversed) Intronic
900354547 1:2253966-2253988 AGCCAGGATGGGCATCCAGAAGG - Intronic
909993263 1:82249315-82249337 TGCAATGATGAGCATTTACATGG + Intergenic
911895866 1:103434155-103434177 AGCTATGTTGAGCATACTCATGG - Intergenic
912924328 1:113900628-113900650 AGACATGATCAGCATACACTGGG + Intronic
916204531 1:162302544-162302566 ACTCATGATCAGCATCCATAAGG - Intronic
917702086 1:177591651-177591673 AGCCATGGTGATGAACCACAGGG + Intergenic
920179408 1:204123183-204123205 AGCCATGCTGAGCTGCGACATGG + Exonic
922524558 1:226290124-226290146 AGCCATTATAAACATCCAAAGGG + Intronic
922565007 1:226596135-226596157 AGCTCTATTGAGCATCCACAAGG - Intronic
1065453590 10:25883444-25883466 AGCCTTTTTGAGCATTCACATGG - Intergenic
1065933848 10:30503065-30503087 AGCCATGATTAGCATGTAGATGG - Intergenic
1069821369 10:71230627-71230649 ACCCATGGTGAGTATCCAAAGGG - Intronic
1069889297 10:71643363-71643385 AGACATGATGAGCAGAGACATGG - Intronic
1072146718 10:92646965-92646987 AGCCATCATTAACATCCACAGGG - Intronic
1073830428 10:107377288-107377310 ACCCTTGGTGAGCATTCACATGG + Intergenic
1073965948 10:108990082-108990104 ATCCATGATGAGGATCCATGAGG - Intergenic
1074214686 10:111372890-111372912 GGCCATGATGACTTTCCACAAGG - Intergenic
1075443995 10:122501144-122501166 AGCCATCCTGCCCATCCACAGGG + Intronic
1075472530 10:122703074-122703096 CGGCAAGATGAGTATCCACAGGG - Intergenic
1083942431 11:65903579-65903601 GGCCATGCTGAGAATGCACAGGG - Intergenic
1089528333 11:119111123-119111145 AGCCATGATGGTCAACCTCAGGG + Exonic
1093080609 12:14806446-14806468 AGCCATTATGAAAATCCAAAAGG - Exonic
1095820312 12:46471162-46471184 AGCCATGGTGACCATGCCCAGGG - Intergenic
1097194868 12:57237704-57237726 AGCCATGATTAACATACACCTGG - Intronic
1111679323 13:91424722-91424744 AGCCATGACTAGCATCCCAAGGG + Intronic
1114539629 14:23445239-23445261 AGCCATTATGCCCAGCCACATGG + Intergenic
1116017190 14:39421327-39421349 ATACGTGATGAGCATCTACATGG + Intronic
1118081225 14:62363040-62363062 TGCTATGATGAACATGCACATGG + Intergenic
1118682740 14:68260154-68260176 AGTCATGAGAAGCATCCCCATGG + Intronic
1119001583 14:70886809-70886831 AACCAGAATGAGCTTCCACAAGG - Intergenic
1120849292 14:89155009-89155031 AGGCATGCTGATCATCCACGTGG + Intronic
1121106678 14:91284505-91284527 AGCTAAAATGAGGATCCACAGGG + Intronic
1121604812 14:95232850-95232872 AGTCTTGATGTCCATCCACAGGG - Intronic
1123503655 15:20915752-20915774 AGCCATGATGGGGATCAGCATGG + Intergenic
1123560900 15:21489426-21489448 AGCCATGATGAGGATCAGCATGG + Intergenic
1123597142 15:21926717-21926739 AGCCATGATGGGGATCAGCATGG + Intergenic
1124051254 15:26199118-26199140 AGCCAAGATGAGCATTTAAAAGG - Intergenic
1126021164 15:44402912-44402934 AGCCATGCTGCGGATCAACAGGG - Exonic
1128664024 15:69525196-69525218 AGCAATGATCAGAATGCACATGG + Intergenic
1129658410 15:77539821-77539843 AGCCATGGTGAGGAGCCACAAGG + Intergenic
1129968887 15:79759985-79760007 TCCCATCCTGAGCATCCACAGGG - Intergenic
1130156910 15:81358449-81358471 AGCCAGGAAGACCATCCCCAAGG - Exonic
1202969247 15_KI270727v1_random:216590-216612 AGCCATGATGGGGATCAGCATGG + Intergenic
1137383880 16:48023681-48023703 AGACATGATGAGGAGCCCCAGGG + Intergenic
1137620519 16:49873705-49873727 TGCCATGATGAGATTCCACTCGG - Intergenic
1138541688 16:57691491-57691513 TGCCATGTTGAGCACCCATAAGG + Intergenic
1140758574 16:78090905-78090927 AGCCACCATGCTCATCCACATGG - Intergenic
1141785566 16:86198322-86198344 AGCCCGGCTTAGCATCCACACGG + Intergenic
1144720724 17:17468049-17468071 AGGCATGATAATCAGCCACAGGG - Intergenic
1144848905 17:18234213-18234235 AGCCATGGTGGGCATGCACAAGG - Intronic
1148332459 17:46820578-46820600 AGCCATGAGGAGCATCTCTAGGG - Intronic
1148999083 17:51738637-51738659 AGCCATGATGAGCATCCACAAGG - Intronic
1154043011 18:10877211-10877233 GGCCCTAATCAGCATCCACATGG + Intronic
1157400128 18:47380353-47380375 AGCCATGATGTACAGTCACATGG - Intergenic
1157731260 18:50006418-50006440 AGCCATGATTCGGGTCCACATGG + Intronic
1158127654 18:54119897-54119919 AGCCATTATGCCCATCCACTTGG + Intergenic
1161431143 19:4233119-4233141 AGCCATGCCGAGCCTGCACAGGG - Exonic
1162745673 19:12796719-12796741 GGCGAAGATGAGCAACCACAGGG + Intronic
1164760590 19:30725675-30725697 AGCCAACATGGGCATCCCCATGG + Intergenic
1165879424 19:39032012-39032034 GGCCAGGATCAGCAGCCACAGGG + Exonic
925088121 2:1128804-1128826 AGCCAGGATGAGAGTGCACAGGG + Intronic
925128440 2:1477708-1477730 AGCCATCATGGGCGCCCACATGG + Intronic
926632871 2:15153188-15153210 ACCCATGATGATTAGCCACATGG + Intergenic
930516842 2:52419185-52419207 AGCCATGATTAGGAATCACAGGG + Intergenic
932563876 2:72893717-72893739 AACCCCGATGATCATCCACAAGG - Intergenic
933123010 2:78566154-78566176 AGCCATGGTGAAGATACACATGG + Intergenic
938368034 2:130750799-130750821 GGCCATCATAAGCATCCTCAAGG + Intergenic
941160332 2:162027925-162027947 TGCCTTGCTGAGCATGCACAGGG - Intronic
943633852 2:190283450-190283472 AGCAATGGTGAGCATACACCTGG - Intronic
944276412 2:197843550-197843572 AAGCATGATGAGAATCCACAAGG + Intronic
946401970 2:219472971-219472993 AGCCAGGGTGGGCAGCCACAGGG + Exonic
946459290 2:219854782-219854804 AGCCAAGATGAGAAGCCAGAAGG - Intergenic
948741087 2:240046408-240046430 AACCATGAAGGGCATCCACAGGG + Intergenic
1172759349 20:37311140-37311162 AGGCTCGGTGAGCATCCACATGG + Intronic
1175634676 20:60570420-60570442 ACCCATGATGTGCATGCACTGGG - Intergenic
1175765689 20:61590963-61590985 AGCCATGAACAGCATCCAGATGG + Intronic
1175933912 20:62506368-62506390 AGCCAGGAGGAGCAGCCACCTGG + Intergenic
1176269008 20:64225735-64225757 AGCCATGAGGGGCATGCAGAGGG + Intronic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1180083179 21:45496033-45496055 TGCCCTGCTGAGAATCCACAGGG - Intronic
1181374886 22:22449428-22449450 AGCCTTGAGGATGATCCACAAGG - Intergenic
1182969944 22:34564433-34564455 GGCCTTGATGAGAATGCACATGG - Intergenic
1183083197 22:35470318-35470340 GGCCATGAGGAGCTGCCACAGGG - Intergenic
1183971611 22:41481697-41481719 AGCCGTGATGAGCAACAGCACGG - Intronic
950815091 3:15692505-15692527 AGCCATGATGATTTGCCACAGGG + Intronic
953261321 3:41341745-41341767 AGCCCTGCTAAGCATCCCCACGG + Intronic
953804766 3:46058848-46058870 AGCCATGATGACCGGCCATAGGG + Intergenic
953843401 3:46407545-46407567 AACCATGCTCAGCATCAACATGG - Exonic
957678219 3:83397746-83397768 AGAAATAATGAGCATCCAAATGG + Intergenic
963116638 3:141736007-141736029 TGCCATCATGAGCACCCAAAGGG - Intergenic
963160605 3:142148092-142148114 AGCCATGAAGAGAAAACACATGG + Intronic
963776937 3:149449304-149449326 GGCCATGATGAGAATTTACAGGG - Intergenic
964772715 3:160240764-160240786 AGCAATGATGAGCACACACTTGG + Intronic
965273099 3:166644458-166644480 AACCATGCTCAACATCCACATGG - Intergenic
966437486 3:179904917-179904939 AGCCATGATGGGCATGCAGGAGG - Intronic
969902080 4:10359411-10359433 AGCCTTCATTAGAATCCACAGGG - Intergenic
969967774 4:11014563-11014585 AGCCATCATGACCATGCAGAAGG - Intergenic
974547186 4:63327611-63327633 ATACAAGATGACCATCCACAAGG - Intergenic
976037811 4:80845399-80845421 AGCCATTATTAGAACCCACATGG + Intronic
976061945 4:81138783-81138805 AGCTATGATGAGCAGCTTCAGGG - Intronic
980331234 4:131414465-131414487 AGGCAGGATGATCATCCACCAGG + Intergenic
981349425 4:143711735-143711757 AGCCATGAGGGGGCTCCACAGGG + Intergenic
984205823 4:176786799-176786821 AGGAATTAGGAGCATCCACATGG + Intronic
986730988 5:10634843-10634865 AACCATGATGAGTAACCAAAAGG - Intronic
990998054 5:61753192-61753214 AGCCAAGATGACCATCCAACTGG - Intergenic
993826912 5:92700535-92700557 AGCTATGACCAGAATCCACAGGG + Intergenic
997855017 5:137365250-137365272 AGCCATTCTGTCCATCCACACGG + Intronic
999498221 5:152121128-152121150 AGGCATGATTCACATCCACAAGG + Intergenic
1002328932 5:178428552-178428574 AGCCAGGAGGAGCATCCAAGAGG - Intronic
1013396264 6:109743950-109743972 AGCCATGCAGAGAAGCCACATGG - Intronic
1015002339 6:128233634-128233656 AGCAATGATGAGCCTCACCAAGG + Intronic
1016002133 6:139052491-139052513 AGTCATGATTAACATCCTCAGGG - Intergenic
1018561247 6:165102789-165102811 TGCCATGAGCAGCTTCCACACGG - Intergenic
1021593576 7:22291055-22291077 CACAATGATGAGCAGCCACAGGG + Intronic
1022956357 7:35385153-35385175 AGGCCTGAGGAGCAGCCACATGG - Intergenic
1023979201 7:45057080-45057102 TGCCATGATGAGCATTCAATGGG - Intronic
1024572340 7:50733668-50733690 TGCCATGATCAGCAGCCCCAAGG + Intronic
1025013042 7:55414575-55414597 ACACATGATGAGCATCTACAGGG - Intronic
1027846441 7:83383117-83383139 AACCCTGATGAGCATCGTCAGGG + Intronic
1028994921 7:97089785-97089807 ACCCAGGCTGAGCAGCCACAGGG + Intergenic
1029533210 7:101139118-101139140 AGCCATGTACAGGATCCACAGGG + Exonic
1032945827 7:136851496-136851518 AGCCAGGATAGGCCTCCACACGG + Intergenic
1035329065 7:158084781-158084803 ACCCACGATGCCCATCCACACGG + Intronic
1037726896 8:21490428-21490450 AGCCTTGAAGAGCTTCCTCACGG - Intergenic
1038674942 8:29615059-29615081 AGCCATGAACAGCACCCAGAAGG - Intergenic
1039723744 8:40193030-40193052 AGCAATTCTGAGCACCCACAGGG - Intergenic
1042179175 8:66067676-66067698 AGCCATGAGGAAAAGCCACATGG + Intronic
1042779100 8:72469913-72469935 AGTGATGATGAGCTACCACATGG - Intergenic
1046110056 8:109711953-109711975 AGCCTGGGTGTGCATCCACAAGG + Intergenic
1053203897 9:36170720-36170742 AGGAAAGATGAGCATCCCCATGG + Exonic
1057912815 9:99033522-99033544 AGCCATCAAGAGAAACCACAGGG - Intronic
1059351913 9:113671523-113671545 AGGCGTGATGAGCGTTCACAGGG + Intergenic
1060893361 9:127202411-127202433 GGCCATAAAGAGCTTCCACACGG + Intronic
1061613876 9:131766551-131766573 AGGTTTGATGAGCAGCCACAGGG + Intergenic
1188722627 X:33542411-33542433 AGCAGTGATGAGCCTCCACAAGG + Intergenic
1191162573 X:57347038-57347060 ATACAAGATGACCATCCACAAGG - Intronic
1197393497 X:125897369-125897391 ATGCAAGATGACCATCCACAAGG - Intergenic
1199313718 X:146351404-146351426 AGCCCTGAGGAGCAGCCCCAAGG - Intergenic
1201285258 Y:12373849-12373871 AGCCAGGGTGAGAATCCCCAGGG - Intergenic