ID: 1149001170

View in Genome Browser
Species Human (GRCh38)
Location 17:51759118-51759140
Sequence CTTGTCAAGCCCCTCATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149001166_1149001170 7 Left 1149001166 17:51759088-51759110 CCCACTAGCATGTGGAGAGCCTG 0: 1
1: 0
2: 2
3: 10
4: 127
Right 1149001170 17:51759118-51759140 CTTGTCAAGCCCCTCATTGTTGG 0: 1
1: 0
2: 1
3: 6
4: 70
1149001167_1149001170 6 Left 1149001167 17:51759089-51759111 CCACTAGCATGTGGAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 149
Right 1149001170 17:51759118-51759140 CTTGTCAAGCCCCTCATTGTTGG 0: 1
1: 0
2: 1
3: 6
4: 70
1149001165_1149001170 13 Left 1149001165 17:51759082-51759104 CCTTAGCCCACTAGCATGTGGAG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1149001170 17:51759118-51759140 CTTGTCAAGCCCCTCATTGTTGG 0: 1
1: 0
2: 1
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149001170 Original CRISPR CTTGTCAAGCCCCTCATTGT TGG Intronic
902952240 1:19894542-19894564 CAGGTCAAGCCCCTCATCTTCGG - Intronic
904767115 1:32858646-32858668 TTTGTCAAGACCCCCATGGTGGG - Exonic
905285733 1:36879172-36879194 CTTGGCAAGCACTACATTGTAGG - Intronic
905748238 1:40437639-40437661 CTTGTGAAGCCCTACATCGTTGG + Intergenic
907392815 1:54169359-54169381 CTTGCCAAGCACCACACTGTTGG - Intronic
916756558 1:167776120-167776142 CTTTACAAGACCCTCAGTGTCGG - Exonic
918274025 1:182933399-182933421 CTTATCATGCTCCTGATTGTAGG + Intronic
922077835 1:222265617-222265639 CTTGGCAACCCGTTCATTGTGGG - Intergenic
1074761789 10:116672108-116672130 ATGGTCAAGCCCCTCTTTTTTGG - Exonic
1080065565 11:28008485-28008507 CTTGGCAAGGCTGTCATTGTAGG - Intergenic
1083748037 11:64745876-64745898 CTAGTCTAGGCCCTCATTATGGG - Intergenic
1084064933 11:66698648-66698670 CTTGTCCAGCCAGTCTTTGTTGG + Exonic
1085701233 11:78747635-78747657 CCTGTCAAGCCCCTCACTGTGGG + Intronic
1092022935 12:5217102-5217124 CTGGTCAACCCCATCAATGTGGG - Intergenic
1092430113 12:8401551-8401573 CTTGTCTAGCACCTCTTTTTAGG - Intergenic
1109298967 13:60570639-60570661 ATTGTCAATGCCCTCATTGCTGG + Intronic
1111594939 13:90399512-90399534 CTTGTCAGGCCCCTCACAGAAGG - Intergenic
1113437219 13:110302503-110302525 CTTCCCATGCCCCTCAGTGTGGG - Intronic
1122926867 14:104907246-104907268 CTTGTCTATCCCCTGACTGTGGG + Intergenic
1124829942 15:33138509-33138531 CTTGTCTAACCTCTCAATGTGGG + Intronic
1126568445 15:50125132-50125154 CTTGTAAATGCCCTGATTGTTGG - Intronic
1128896774 15:71381029-71381051 CTTGTCAAGCCCATAATCCTAGG - Intronic
1142917480 17:3153834-3153856 TCTGTCAAGCCCCTCACTGGAGG + Intergenic
1147375465 17:40020136-40020158 CTCTCCATGCCCCTCATTGTTGG - Intronic
1149001170 17:51759118-51759140 CTTGTCAAGCCCCTCATTGTTGG + Intronic
1154109390 18:11552697-11552719 CTTCTCAGGCCCCTCAGAGTCGG - Intergenic
1157628085 18:49068292-49068314 CTTTTCAACCCCCTTATTTTGGG - Intronic
1159402275 18:67954010-67954032 CTCCTCAAGGCCCTGATTGTGGG - Intergenic
1160445630 18:78925069-78925091 CTTTTCATGCCCCTCACTGGTGG + Intergenic
1161584534 19:5098018-5098040 CTTTTGAAGCCCCTCCTGGTGGG - Intronic
1161654225 19:5503935-5503957 CTTGTTAAGCCCATGACTGTGGG - Intergenic
926116290 2:10215414-10215436 CTTGTGAAGTCCCTCTCTGTGGG - Intergenic
930721572 2:54643098-54643120 TTTGTCAAGCCATTCTTTGTTGG - Exonic
932583842 2:73009820-73009842 CTAGACAAGCCCATCATTGCAGG - Intronic
945893131 2:215451543-215451565 CTTGTCTATCGCCTCAATGTTGG + Intergenic
947859668 2:233349555-233349577 CTTCTCCAGCCCTTCATTGCTGG - Intergenic
1170735238 20:19008590-19008612 CTTTTCATGCCCCTCATCGAGGG - Intergenic
1174279799 20:49431075-49431097 GTTGTCAAGTCCCTCAGTGATGG - Intronic
1182578044 22:31286882-31286904 CATGTCAAGCATCCCATTGTGGG + Intronic
1183163902 22:36133073-36133095 CTTCTCACCCCCCTCATTCTGGG + Intergenic
951685935 3:25344653-25344675 CTTGGCAAGCTCCTCATTATGGG + Intronic
953187993 3:40656000-40656022 CTTGACATGCCCCTCTCTGTGGG + Intergenic
957073739 3:75585075-75585097 CTTGTCTAGCCCCTCTTTTGAGG - Intergenic
958743843 3:98109690-98109712 CTTCTCAAGCCCCACGTTGTGGG - Intergenic
960953553 3:123015201-123015223 GTTGTTAAGCCCCTCAGTGTGGG + Intronic
961041236 3:123679913-123679935 CTTCTCAAGACCCACAGTGTGGG + Intronic
961993979 3:131221347-131221369 CTTGTCAAACCACACATTGCTGG + Intronic
977907649 4:102497014-102497036 CTTGTCAGTCTCCTCATTCTTGG + Intergenic
978345451 4:107763340-107763362 TTTATCAAGCCTATCATTGTGGG - Intergenic
978998050 4:115179660-115179682 GGTGTTAAGCCCCTCATTGCCGG + Intergenic
983451819 4:167921227-167921249 TTTATCCAGCCTCTCATTGTTGG - Intergenic
983865506 4:172760776-172760798 CTGGTCAGGACCCACATTGTGGG - Intronic
987394494 5:17409502-17409524 CTTGACATGCCCATAATTGTGGG + Intergenic
987871651 5:23626665-23626687 CTTGCCAAGAGGCTCATTGTAGG - Intergenic
989149459 5:38284165-38284187 CTTGGCTTGCCTCTCATTGTTGG + Intronic
995981247 5:118106806-118106828 CTTGTCAAGCTCCTTAGTGATGG - Intergenic
996134080 5:119817524-119817546 CTTGTTAAGCCACTCAGTGTGGG + Intergenic
1005109726 6:22267338-22267360 CTTATCAAGTCACTCACTGTAGG - Intergenic
1006501326 6:34460891-34460913 CTTGACAAGGCCCTCAGTCTTGG - Intergenic
1006625176 6:35392622-35392644 CTTGCCAAGCAGGTCATTGTGGG + Intronic
1008552020 6:52642015-52642037 CTTCTTAAGCCCCTCATTATAGG + Intergenic
1009264848 6:61540651-61540673 CCTGTCAAGCCACTCCTTGTGGG - Intergenic
1018492702 6:164311515-164311537 CTTGTCTTGCCCCTGATTTTAGG - Intergenic
1021227075 7:18040304-18040326 TTTGTCAAGGCCTTCATTATTGG + Intergenic
1021398237 7:20177847-20177869 GTTGTCCAGCCCCAAATTGTTGG + Intronic
1034626653 7:152498357-152498379 CTGCTCAAGCCACTGATTGTTGG + Intergenic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1037243640 8:16805803-16805825 CTTGTCAAAACCCACATTGCTGG - Intergenic
1048335504 8:133499322-133499344 CCTTTCAAGCCACTCAGTGTGGG + Intronic
1053213337 9:36250608-36250630 CTAGTCCAGTCCCTCATTTTAGG + Intronic
1054746291 9:68857164-68857186 CTTGTCAAAACCCTGATTTTAGG + Intronic
1062304880 9:135899909-135899931 CTCCTCAAGCCCGTCATTATGGG + Intronic
1189177683 X:38974374-38974396 GTTTTCAGGCCCCTCATGGTTGG + Intergenic
1198483632 X:137064659-137064681 CTCGTCCAGTCCCTAATTGTTGG + Intergenic
1198601476 X:138288542-138288564 GTTGTAATGCCCCTCTTTGTGGG - Intergenic
1201063242 Y:10067243-10067265 GGTGTCAACCCCCTCATAGTGGG + Intergenic
1201336156 Y:12882181-12882203 CTCTTCAAGCCCTTCATTCTGGG + Intergenic
1202116117 Y:21470029-21470051 TGTGTCAAACCCCTCATAGTGGG - Intergenic