ID: 1149004045

View in Genome Browser
Species Human (GRCh38)
Location 17:51786269-51786291
Sequence AGGGAGGACGCATTGGCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149004043_1149004045 -9 Left 1149004043 17:51786255-51786277 CCAAATATAAGGTCAGGGAGGAC 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1149004045 17:51786269-51786291 AGGGAGGACGCATTGGCTCGTGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149004045 Original CRISPR AGGGAGGACGCATTGGCTCG TGG Intronic
900391349 1:2435305-2435327 AGGGAGGGCACCTGGGCTCGGGG + Intronic
900897763 1:5495798-5495820 AGGGAGAACGCGTTTGCTCTGGG - Intergenic
920026527 1:203002194-203002216 AGAGAGGACGCATTGTCACAAGG + Intergenic
1070459008 10:76646087-76646109 AGGAAGGCCCCATTGGCTTGAGG - Intergenic
1070828865 10:79406651-79406673 AGGGAGGATGAAATGGCTGGTGG - Intronic
1075303311 10:121344934-121344956 AGGGAGGACGACTGGCCTCGGGG - Intergenic
1083168772 11:60909501-60909523 AGGGAGGAATCATTGGTTCTGGG - Intergenic
1084539218 11:69775870-69775892 AGGGAGGACCCTTTGGCTACAGG + Intergenic
1084629185 11:70334799-70334821 AGGCAGGAGGCAATGGCACGGGG - Intronic
1087252202 11:95915273-95915295 AGGGAGGAGGCCTTGTCTGGAGG - Intronic
1088457797 11:110050500-110050522 CGGGAGGAAGCAGTGGCTGGTGG - Intergenic
1091446529 12:546864-546886 AACGAGGACGGATGGGCTCGCGG - Intronic
1091728058 12:2859076-2859098 GGGGAGGACAGATTTGCTCGGGG + Exonic
1093138572 12:15479909-15479931 AGGGAAGACCCCTTGGCTCATGG - Intronic
1095216454 12:39555854-39555876 AGGCAGGACTCAGTGGCTGGGGG + Intronic
1105831230 13:24164531-24164553 AGGGAGGAAGCATTTGCGTGAGG + Intronic
1107419151 13:40230325-40230347 ACGCAGGACGCAGTGCCTCGTGG - Intergenic
1107964799 13:45588867-45588889 AGGGAGGAGCCATTGGATCCTGG + Intronic
1121090713 14:91180168-91180190 AGGCAGGGCGCAGTGGCTCACGG - Intronic
1129329650 15:74820534-74820556 AGGGAGGAAGGCTGGGCTCGTGG + Intronic
1131177818 15:90220952-90220974 AGGGTGGACACATGGGCTCAGGG - Intronic
1133626478 16:7574906-7574928 GTGGAGGACGCATTGCCTCCTGG + Intronic
1134870277 16:17646615-17646637 GAGGAGGGCGCATGGGCTCGAGG + Intergenic
1135464695 16:22675329-22675351 AGGGAGGAGGCAGTAGCTAGTGG + Intergenic
1135741689 16:24980740-24980762 AGGGATGAGGCATTGGCGAGAGG - Intronic
1137579250 16:49623267-49623289 AGGGAAGGCGCCTTGGCTGGGGG - Intronic
1137848527 16:51715234-51715256 TGGGAGGAGGCATTGGCACCAGG + Intergenic
1142648986 17:1334184-1334206 AGGCCGGGCGCATTGGCCCGGGG + Intergenic
1145934286 17:28705863-28705885 AGGGAGCAGGCACTGGCTTGGGG + Intronic
1148631423 17:49112647-49112669 AGGGTGGACTCAGTGGCTCAAGG - Intergenic
1149004045 17:51786269-51786291 AGGGAGGACGCATTGGCTCGTGG + Intronic
1151932982 17:77244494-77244516 CGGGAGGACACATTGGCACAGGG + Intergenic
1151954867 17:77375141-77375163 AGGGAGGTCACATTCACTCGGGG - Intronic
1152528368 17:80902578-80902600 AGGGCAGACGCATGGGCTGGGGG - Intronic
1154211463 18:12382607-12382629 AGGCAGGGCGCAGTGGCTCACGG + Intergenic
1155408228 18:25513398-25513420 CAGGAGGACCCATTGGTTCGTGG - Intergenic
1156095861 18:33531059-33531081 AGGGAGGTGGCATTGGCTGCTGG + Intergenic
1160722444 19:603422-603444 TCGGAGGAGGCACTGGCTCGAGG + Intronic
1160967863 19:1754425-1754447 GCGGAGGACGCACTGGCCCGCGG + Exonic
1161233097 19:3185256-3185278 AGGGAGGCCGCAGTGGGTTGTGG - Intergenic
1166081184 19:40444740-40444762 AGGGAGGACGCTGGGGCGCGGGG + Intergenic
1168104916 19:54160741-54160763 AGGGAGGAGGCCTAGGCTCCTGG - Intronic
927654316 2:24932661-24932683 AGGGAGGGCGTGTTGGGTCGAGG + Intergenic
930475350 2:51875149-51875171 AGAGAGGACACAGTGGCTGGGGG + Intergenic
939629694 2:144516980-144517002 AGGGCGGAGGCAGGGGCTCGAGG + Intronic
944177629 2:196850619-196850641 AGCAAGGAAGCATTGGCTCTTGG + Intronic
948584154 2:239008276-239008298 AGGAAGGACGCAGTGGCATGAGG - Intergenic
1169022727 20:2341498-2341520 CGGAAGGACGCATTTGCTCCTGG - Intergenic
1169404751 20:5314299-5314321 AGGGAGGAGGCATGGTCTTGGGG + Exonic
1172546152 20:35763215-35763237 AGGCTGGACGCAGTGGCTCATGG - Intergenic
1174107225 20:48171331-48171353 AGGGAGGTCGCATGGGGCCGGGG + Intergenic
1174520045 20:51122304-51122326 ATGGAGGATGGATTGGCTCAGGG - Intergenic
1175249437 20:57600294-57600316 AGGGAGGAGGAATTTGCTCCAGG - Intergenic
1177167958 21:17624161-17624183 AGGGAGAAAGCATGGGCTGGGGG - Intergenic
1179606904 21:42522542-42522564 ATGGGGGACGCAGTGGCTGGAGG - Intronic
1179883021 21:44301201-44301223 AGGGAGGCAGGAGTGGCTCGTGG + Intronic
1180414022 22:12693044-12693066 GGGGAGGACGCATTTTCTGGGGG + Intergenic
1181031528 22:20150612-20150634 AGGGGGGATCCATTGGCTCAGGG - Exonic
951906712 3:27714122-27714144 AGGGAGGAGATACTGGCTCGGGG - Intergenic
957445376 3:80308786-80308808 AGGTAGGACGCATTGGCAGAAGG + Intergenic
959817543 3:110692591-110692613 AGGTAGGTCTCATTGGCTGGGGG - Intergenic
968771999 4:2513358-2513380 AAGGAGGACGCATTTGCACCCGG - Intronic
975012843 4:69377708-69377730 AGGTAGGACGCATTGGCAGAAGG + Intronic
977202557 4:94133536-94133558 AGGCAGGGCGCAGTGGCTCATGG - Intergenic
986836615 5:11646135-11646157 AGGGAGGGCCCATGGGCTCATGG - Intronic
994613728 5:102077939-102077961 AGGGAGGATGCAGTGGCGCTAGG - Intergenic
995376227 5:111477196-111477218 AGGGAGAACACATTGGCCCAGGG + Intronic
1006130466 6:31865962-31865984 AGCGAGGACGCATTGGCCCAGGG + Exonic
1017343468 6:153353420-153353442 AGGGAGGATGCAGTGGCGCATGG - Intergenic
1029630369 7:101746459-101746481 AAGGAGGAGGCACTGGCTGGGGG - Intergenic
1035378077 7:158420170-158420192 AGGCAGGACACATTGTCTCACGG + Intronic
1035683228 8:1504016-1504038 AAGGTGGACGCATTGGTTCCAGG + Intronic
1036571027 8:9979984-9980006 AGGGAGGAGGCAGTGGCTGGAGG + Intergenic
1038078201 8:24101908-24101930 AGGAAGGACCCTTTGGCTCAAGG - Intergenic
1038596340 8:28890128-28890150 AGGGAGGATGCATTGGCGGCTGG - Intronic
1039433183 8:37541698-37541720 AAGGAGGATGCATTTGTTCGAGG - Intergenic
1041390477 8:57343282-57343304 AGGGAGGACGCTTTTCCTCAAGG + Intergenic
1048535599 8:135291413-135291435 AGGGATGCCTCATTGGCTGGTGG + Intergenic
1048995422 8:139791044-139791066 AAGGAGGGTGAATTGGCTCGTGG - Intronic
1049154112 8:141056512-141056534 AGGGAGGACACATGGGCGAGAGG + Intergenic
1050024430 9:1319499-1319521 AAGGAGGAGACATTGCCTCGTGG + Intergenic
1055577823 9:77677766-77677788 AGGGAGGAGGCATTCCCTGGGGG - Intergenic
1061896725 9:133652164-133652186 AGGGAGGACACAGTGGCCGGGGG + Intronic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1192175103 X:68880431-68880453 AGGGAGGAGGCAAGGGCTCCTGG + Intergenic
1197216818 X:123874145-123874167 AGGGAGGAAGCATTGTCACATGG + Intronic