ID: 1149004345

View in Genome Browser
Species Human (GRCh38)
Location 17:51789647-51789669
Sequence CTAACATATCCTCCCTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149004339_1149004345 3 Left 1149004339 17:51789621-51789643 CCCACTCTTGCCTCCACTCCACC 0: 1
1: 0
2: 1
3: 65
4: 520
Right 1149004345 17:51789647-51789669 CTAACATATCCTCCCTTCCTTGG 0: 1
1: 0
2: 0
3: 16
4: 160
1149004336_1149004345 30 Left 1149004336 17:51789594-51789616 CCCTCAGTTTTGAAGCCTGTTTC 0: 1
1: 0
2: 1
3: 25
4: 268
Right 1149004345 17:51789647-51789669 CTAACATATCCTCCCTTCCTTGG 0: 1
1: 0
2: 0
3: 16
4: 160
1149004337_1149004345 29 Left 1149004337 17:51789595-51789617 CCTCAGTTTTGAAGCCTGTTTCT 0: 1
1: 0
2: 4
3: 28
4: 308
Right 1149004345 17:51789647-51789669 CTAACATATCCTCCCTTCCTTGG 0: 1
1: 0
2: 0
3: 16
4: 160
1149004340_1149004345 2 Left 1149004340 17:51789622-51789644 CCACTCTTGCCTCCACTCCACCT 0: 1
1: 0
2: 6
3: 71
4: 730
Right 1149004345 17:51789647-51789669 CTAACATATCCTCCCTTCCTTGG 0: 1
1: 0
2: 0
3: 16
4: 160
1149004338_1149004345 15 Left 1149004338 17:51789609-51789631 CCTGTTTCTCTGCCCACTCTTGC 0: 1
1: 0
2: 0
3: 37
4: 389
Right 1149004345 17:51789647-51789669 CTAACATATCCTCCCTTCCTTGG 0: 1
1: 0
2: 0
3: 16
4: 160
1149004341_1149004345 -7 Left 1149004341 17:51789631-51789653 CCTCCACTCCACCTGACTAACAT 0: 1
1: 0
2: 3
3: 58
4: 1130
Right 1149004345 17:51789647-51789669 CTAACATATCCTCCCTTCCTTGG 0: 1
1: 0
2: 0
3: 16
4: 160
1149004342_1149004345 -10 Left 1149004342 17:51789634-51789656 CCACTCCACCTGACTAACATATC 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1149004345 17:51789647-51789669 CTAACATATCCTCCCTTCCTTGG 0: 1
1: 0
2: 0
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149004345 Original CRISPR CTAACATATCCTCCCTTCCT TGG Intronic