ID: 1149006950

View in Genome Browser
Species Human (GRCh38)
Location 17:51815930-51815952
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2511
Summary {0: 1, 1: 3, 2: 131, 3: 812, 4: 1564}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149006950 Original CRISPR AATAACTACAAGAGTGTAGT TGG (reversed) Intronic
Too many off-targets to display for this crispr