ID: 1149007924

View in Genome Browser
Species Human (GRCh38)
Location 17:51824732-51824754
Sequence GTCTAGGAGCAGTTGCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149007924_1149007927 -10 Left 1149007924 17:51824732-51824754 CCTTTGGGCAACTGCTCCTAGAC 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1149007927 17:51824745-51824767 GCTCCTAGACTTTGGGATATCGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149007924 Original CRISPR GTCTAGGAGCAGTTGCCCAA AGG (reversed) Intronic
900775889 1:4585275-4585297 GTCTCGGTGGAGATGCCCAAAGG + Intergenic
901365096 1:8740230-8740252 GTCTAGGAGCAGTAGGCTATAGG - Intronic
902335123 1:15750168-15750190 GGCTGGGACCAGTTCCCCAAGGG + Intergenic
903396582 1:23006275-23006297 GTTTTGGAGGAGTTGCCCAGGGG + Intergenic
904480954 1:30793170-30793192 GACTTGGGGCAGGTGCCCAATGG + Intergenic
904524470 1:31122399-31122421 GTCTTGGAGCAGTTGCCTGCTGG - Intergenic
905956358 1:42000486-42000508 GTAGAGGAGCAGGTTCCCAAAGG + Intronic
915507376 1:156366433-156366455 GGCAAGTAGCTGTTGCCCAAAGG + Intronic
923042795 1:230331798-230331820 GTCTAGGATCAGTTGAAGAAAGG - Intronic
1066301271 10:34099481-34099503 GTCTTGGAGATGTTGCCCACTGG - Intergenic
1066636838 10:37511625-37511647 CTGTAGGAGCAGTGTCCCAATGG + Intergenic
1067269262 10:44775363-44775385 GTGTAGAAGGAATTGCCCAAAGG - Intergenic
1091817844 12:3453337-3453359 GTCTGGCAGCAGATCCCCAAGGG + Intronic
1092124652 12:6066615-6066637 GTCTAGCATCTGTTCCCCAAAGG - Intronic
1092140647 12:6180936-6180958 GCCTGGGAGCAGAGGCCCAAAGG + Intergenic
1096485402 12:51977034-51977056 GACTTGTACCAGTTGCCCAAGGG + Intronic
1102259914 12:111437456-111437478 GTCTAGGAGCCGCTGCCCTGTGG + Intronic
1107442290 13:40439038-40439060 GTCAGGGAGCCGTTGCCAAAGGG - Intergenic
1107876363 13:44794103-44794125 GCCTAGGAACAGTTGTCCAGGGG + Intergenic
1108205309 13:48082991-48083013 GTCCCAGCGCAGTTGCCCAATGG + Intronic
1117770176 14:59126342-59126364 GTTTATGAGCAGTTGCCGTAGGG + Intergenic
1134371988 16:13634281-13634303 GTCTGGGAACAGGTCCCCAAAGG + Intergenic
1135207980 16:20499133-20499155 GTCCAGGATGAGTTGCCCACTGG + Intergenic
1135210919 16:20524567-20524589 GTCCAGGATGAGTTGCCCACTGG - Intergenic
1149007924 17:51824732-51824754 GTCTAGGAGCAGTTGCCCAAAGG - Intronic
1151672027 17:75576117-75576139 GTAGGGGAGCAGTTCCCCAAAGG + Intergenic
1165146410 19:33733837-33733859 CTCTAGGAGCACTTTCTCAACGG + Intronic
1166313950 19:41978284-41978306 CCCGAGGAGCAGTTCCCCAAGGG - Exonic
1168180401 19:54658795-54658817 GTCTGGGAGCAGTTGGCCTGGGG - Intronic
926934927 2:18077367-18077389 ATTTAGAAGCAGTTGCCAAATGG - Intronic
928663662 2:33529071-33529093 CTCTATGAGAAATTGCCCAAGGG - Intronic
929559142 2:42945030-42945052 TTCTAGGAGCACTTGCCCAGTGG - Intergenic
937911676 2:127078609-127078631 ATCCAGCTGCAGTTGCCCAAGGG - Intronic
942604045 2:177671881-177671903 CTCAAGGAGCAGTAGCCCCAGGG - Intronic
942735603 2:179108334-179108356 GTCTAGGAAAGGTTGCTCAATGG + Exonic
944297082 2:198077719-198077741 ATCTAGGTGAAGTTGCCCAATGG - Intronic
945120522 2:206452675-206452697 ACCCAGGAGCATTTGCCCAATGG + Intronic
948659315 2:239497426-239497448 GTCTCTGAGCTGTGGCCCAAAGG + Intergenic
1169685547 20:8267293-8267315 GGCTAGGAGCAGTTCTCCATAGG - Intronic
1171156689 20:22880883-22880905 CTCTAGGAGCATTTTCCCATCGG + Intergenic
1174149003 20:48472942-48472964 GTCTTGGAGCTGTTGTCCCAAGG - Intergenic
1174172755 20:48627557-48627579 GTCAAGGACCAGATGCCCCAGGG - Exonic
1176890572 21:14313073-14313095 GATTTGGAGCAGTTGCCAAAGGG + Intergenic
1180912808 22:19464727-19464749 GCCTAGGAGGTGTTGCCCTAAGG + Intronic
1185036286 22:48478878-48478900 GTGAAGGAGCAGTTCCCCAGGGG + Intergenic
953494988 3:43378225-43378247 GAGTAGGAGCAGCTGCCAAAGGG + Intronic
953834509 3:46331168-46331190 GTCTAAGAGTTGTTGCCAAAGGG + Intergenic
954675722 3:52314348-52314370 CTCCAGGAGCAGCGGCCCAAGGG - Intergenic
954876879 3:53808091-53808113 GACTCGGATCAGTTGCCCTATGG + Intronic
959929925 3:111969066-111969088 GTCCAGGACCAGATGCCAAAGGG - Intronic
961655786 3:128440927-128440949 GTCTAAGAGGAGTGGCCCATGGG - Intergenic
961916900 3:130385548-130385570 GTCTATAAACAGTTGCCCCAAGG + Intronic
962687894 3:137865175-137865197 GGGCAGGAGCAGTTCCCCAAAGG - Intergenic
962922959 3:139967104-139967126 GTTTAGGAGCACTGGCCCAGGGG - Intronic
972872483 4:43317027-43317049 GCCTGAGAGCAGGTGCCCAAGGG - Intergenic
976697977 4:87938259-87938281 GAATTGGAGCAGTTGTCCAAGGG + Intergenic
977039706 4:92001510-92001532 GACTAGAAGCAGCTGCCCACTGG + Intergenic
985984405 5:3502720-3502742 TTCTAGGAGCTGCAGCCCAAAGG - Intergenic
986519770 5:8602270-8602292 GACTTTGGGCAGTTGCCCAAAGG - Intergenic
988179668 5:27773494-27773516 GTTGAGGAGCTGTGGCCCAAAGG + Intergenic
988311038 5:29557113-29557135 GTTTTGGAGCAGTTGTGCAAAGG + Intergenic
993284038 5:85966497-85966519 CTCCAGGAGCATTTGCCAAAGGG + Intergenic
999951484 5:156656393-156656415 GTTTAGGTAAAGTTGCCCAAAGG + Intronic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1003516104 6:6820169-6820191 ATTTAGCAGCAGTTGCCTAAAGG - Intergenic
1006673174 6:35742746-35742768 GCCTAGTAGCAGCTGCCCATGGG - Intronic
1016792128 6:148077099-148077121 TTCTAAGAGCAGGAGCCCAATGG + Intergenic
1020835539 7:13145823-13145845 TTCTAGGAACAGTTGATCAATGG - Intergenic
1023113840 7:36841129-36841151 CTCTAGGAGCAAGTGCCCAAGGG - Intergenic
1027598948 7:80214051-80214073 GTCTAGGAGCAGGAGGACAATGG - Intronic
1029035214 7:97512864-97512886 GTATAGAAGCAGTTGGCCACAGG + Intergenic
1031121062 7:117722890-117722912 GATTTGGAGCAGGTGCCCAAGGG + Intronic
1032098010 7:128949092-128949114 GTATAGGAGGAATTGCCTAAGGG + Intronic
1032405827 7:131654811-131654833 GCTCAGGAGCAGCTGCCCAAAGG - Intergenic
1039784058 8:40816891-40816913 GTCTAGAAGCAATTGGCAAATGG - Intronic
1041143293 8:54845092-54845114 GTCTAGGAGATGTGGCCAAAGGG + Intergenic
1042418559 8:68557340-68557362 GTTTAGGATCAGTTTTCCAAAGG - Intronic
1048610273 8:136014806-136014828 GTCCAGGAGCCGTTTCCCAGTGG - Intergenic
1056232530 9:84561269-84561291 GAGGAGAAGCAGTTGCCCAAAGG + Intergenic
1058583976 9:106486970-106486992 GTCAAGGAGTAGTTCCTCAAAGG + Intergenic
1061467686 9:130795155-130795177 GGCAAGGAGCAGTTCACCAATGG - Intronic
1191014240 X:55792066-55792088 GTCTAAGAGTTGTTGCCAAATGG + Intergenic
1195978525 X:110553837-110553859 GTTTTGAAGCAGTTGACCAATGG - Intergenic