ID: 1149010628

View in Genome Browser
Species Human (GRCh38)
Location 17:51853220-51853242
Sequence CCTGATTAGCAGTTTCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149010628_1149010635 23 Left 1149010628 17:51853220-51853242 CCCCACAGAAACTGCTAATCAGG 0: 1
1: 0
2: 2
3: 11
4: 125
Right 1149010635 17:51853266-51853288 TGATCTAATGCTGAAAGCCTTGG 0: 1
1: 0
2: 3
3: 17
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149010628 Original CRISPR CCTGATTAGCAGTTTCTGTG GGG (reversed) Intronic
902120803 1:14163917-14163939 CCTCACCAGCAGCTTCTGTGAGG + Intergenic
907928111 1:58973652-58973674 TCTGATTAGCTGTTTGGGTGGGG - Intergenic
912911839 1:113769073-113769095 GCTGATTAGGTTTTTCTGTGGGG - Intronic
913091282 1:115478458-115478480 CCTGAGGAAGAGTTTCTGTGGGG - Intergenic
913122700 1:115756298-115756320 CCAGATAAGCTGTTTCTGTTTGG - Intronic
914973145 1:152329848-152329870 ACTCATTAACAGTTTCTTTGAGG + Intergenic
915957697 1:160236462-160236484 CCTCTCTAGTAGTTTCTGTGAGG - Intronic
916682355 1:167116036-167116058 CCTGATGGGCAGTCTCTGGGTGG - Intronic
917245180 1:172993173-172993195 CCTGCTTAGCAGTTATTGGGAGG + Intergenic
917770322 1:178269950-178269972 CCTGATTAGCAGTTCGTGGTAGG + Intronic
919457991 1:197842757-197842779 CCTGATTAGGAGTCATTGTGAGG - Intergenic
920251220 1:204623638-204623660 GCTGATTAGCAGTTTCTACCGGG + Intronic
1067433393 10:46260466-46260488 CCTGATTTGCAGTTTGTCTCTGG - Intergenic
1069942730 10:71966008-71966030 GCTGTTTGGCAGATTCTGTGGGG + Intronic
1075922737 10:126226369-126226391 CCTGGTGAGGAGCTTCTGTGTGG + Intronic
1078819367 11:14862126-14862148 GCTGATCACCAGTTTCTGTTGGG + Intronic
1081742415 11:45449852-45449874 ACTGATTGGCAGTTTCTAAGGGG - Intergenic
1083171024 11:60924253-60924275 CCTGATCAGAAGCTTCCGTGAGG + Intergenic
1085191900 11:74633597-74633619 CCTGACCAGCACTTTCTTTGTGG + Intronic
1085487896 11:76883761-76883783 CTTGTTTAGCAATTTCTGTTTGG + Intronic
1090939178 11:131372537-131372559 TCGGAAAAGCAGTTTCTGTGGGG + Intronic
1091552378 12:1546335-1546357 TGTGAGTAGCAGTTTCTTTGGGG + Intronic
1091592507 12:1853124-1853146 CCTCATTAGCTGTTTCTGGTTGG - Intronic
1091745130 12:2987128-2987150 CCTGGTAGGCAGTTTCTGTGAGG + Intronic
1092298442 12:7222066-7222088 CCAGAGTAGCAGTAGCTGTGAGG + Intergenic
1093205548 12:16244438-16244460 AATGATGAGAAGTTTCTGTGGGG + Intronic
1093798860 12:23347163-23347185 CCTAAGTAGCATTTTCTTTGCGG - Intergenic
1096304348 12:50461255-50461277 CCTGATGCCCAGTTACTGTGGGG - Exonic
1098471970 12:70855592-70855614 CAAGGTTGGCAGTTTCTGTGTGG - Intronic
1100520566 12:95371347-95371369 CCAGACAAGCAGTTTTTGTGAGG - Intergenic
1100831799 12:98523143-98523165 CATGATTAGCAGTTTCAGTCAGG - Intronic
1101401036 12:104387167-104387189 CCTGTTTAGAAATTACTGTGAGG - Intergenic
1108966769 13:56316800-56316822 CAGAATTAGCAATTTCTGTGAGG - Intergenic
1109309883 13:60680107-60680129 CCTGAACAGCAGCCTCTGTGAGG + Intergenic
1110689577 13:78416644-78416666 CCTTATCAGCTGTTTCTGTAAGG - Intergenic
1111982805 13:95034604-95034626 CCTGTTTTGCTGTTTCAGTGAGG + Exonic
1113149653 13:107248722-107248744 ACCCATTAGAAGTTTCTGTGGGG - Intronic
1123430637 15:20212859-20212881 ACCGATTATCAGTTTTTGTGAGG - Intergenic
1125024732 15:35019126-35019148 TCTTATAAGCAGCTTCTGTGGGG - Intergenic
1128004214 15:64223196-64223218 GCTGATAAGCCGTTACTGTGTGG - Intronic
1128140389 15:65296254-65296276 AGTGACTAGCAGATTCTGTGTGG + Intronic
1131192056 15:90324708-90324730 CCTGATTAGCAGCAGTTGTGAGG - Intergenic
1131723198 15:95194330-95194352 TCTGATTAGGAGTCTGTGTGAGG - Intergenic
1133576105 16:7091827-7091849 CCTGATTTGTAGATTCTATGTGG + Intronic
1133599084 16:7321805-7321827 CCAGATTAGCAGTGTCCTTGTGG - Intronic
1133735268 16:8610184-8610206 CCAGATGCACAGTTTCTGTGTGG - Intergenic
1136854002 16:33638358-33638380 ACTGATTATCAGTTTTTGTGAGG + Intergenic
1137730474 16:50686042-50686064 GCTGATGAGCAGTTTGGGTGGGG + Intergenic
1138594866 16:58024643-58024665 CCTGATTTCCAGTTTCCGGGAGG + Intergenic
1139532569 16:67549695-67549717 CTTCATTAGCAGTTTATATGAGG - Intergenic
1203115582 16_KI270728v1_random:1486797-1486819 ACCGATTATCAGTTTTTGTGAGG + Intergenic
1146712253 17:35052452-35052474 CCTCATTAGCAGTCACTATGTGG - Intronic
1146794090 17:35769424-35769446 CCTGATTAGCAGATGCTCTTGGG - Intronic
1147598614 17:41732621-41732643 CCTGATTGGCAGTCTCTCTGGGG - Intronic
1148122434 17:45221237-45221259 CCTGTTTAGGAGTTCCTGTTTGG + Intergenic
1149010628 17:51853220-51853242 CCTGATTAGCAGTTTCTGTGGGG - Intronic
1149548127 17:57519323-57519345 TATGATGAGCATTTTCTGTGTGG + Intronic
1149856315 17:60086112-60086134 ACTGATTAGCAGTATCTGAGGGG + Intergenic
1150417472 17:64999044-64999066 CCTGGTTTCCAGTTTCTTTGGGG + Intergenic
1150794188 17:68224875-68224897 CCTGGTTTCCAGTTTCTTTGGGG - Intergenic
1150837874 17:68580815-68580837 CCTTATGAGGAGTTTCTGTGGGG - Intronic
1152667649 17:81580536-81580558 CCTGCTTATCACTCTCTGTGTGG + Intronic
1165149519 19:33752633-33752655 TCTCATTAGCAGTGTCTGTCAGG + Intronic
929490768 2:42394251-42394273 CCTTTTTAGCAGTTTTTGTTGGG - Intronic
936840873 2:116766922-116766944 CCTGACTTACACTTTCTGTGTGG + Intergenic
936932218 2:117801787-117801809 ACTCATTAGCAGTTTTTGAGGGG - Intergenic
939819996 2:146945942-146945964 CCAGATTAGCTGTTTCTCTGGGG + Intergenic
1169423222 20:5475837-5475859 CCTGATGATCAGTTTCTGCCTGG + Intergenic
1171296654 20:24023033-24023055 CCTGAGGAGCAGCTTCTGTTGGG - Intergenic
1172300125 20:33843892-33843914 CATGTTTAGGTGTTTCTGTGGGG + Intronic
1174063077 20:47846001-47846023 CCTGGCTTGCAGTGTCTGTGCGG - Intergenic
1174151429 20:48489032-48489054 CCTGGCTTGCAGTGTCTGTGCGG - Intergenic
1175464089 20:59178103-59178125 CGTGTTTAGCAGTAGCTGTGAGG + Intergenic
1177221166 21:18194939-18194961 CATGCTTATCATTTTCTGTGGGG + Intronic
1177664855 21:24141623-24141645 CCAAATTAGCAGTATCTCTGAGG + Intergenic
953946413 3:47152022-47152044 GCAGATTAGCAGTTTGTGTAAGG - Intronic
954154448 3:48677599-48677621 CCTGACAAGCAGTGTCAGTGGGG - Intronic
954578477 3:51690044-51690066 CCTGTTGAGCAGTGGCTGTGAGG + Intronic
957176936 3:76823880-76823902 CCTGATTAGCAGTTGTTTTATGG + Intronic
961809516 3:129513893-129513915 CCTGGTGGGCAGTTTCTGAGCGG - Intronic
963909564 3:150803984-150804006 GCTGATTAACAGTTTCTGTGAGG - Intergenic
968345628 3:198002834-198002856 CCTGTGTAGCAGTCCCTGTGCGG + Intronic
968502661 4:958295-958317 CCTGCTGAGCAGGTTCAGTGTGG + Exonic
969113847 4:4859633-4859655 CCTTATTAGCAAGTTCTCTGGGG + Intergenic
969633311 4:8351078-8351100 CCTGACCAGCAGCCTCTGTGTGG - Intergenic
972241242 4:37195166-37195188 CCTGATTAGCAGTCTACATGAGG - Intergenic
977418997 4:96773710-96773732 CATTATGAGCAATTTCTGTGAGG - Intergenic
978210515 4:106130629-106130651 CCACTTTTGCAGTTTCTGTGTGG - Intronic
984908856 4:184653189-184653211 CCTATTTACCAGTTTCTGGGGGG - Intronic
985238928 4:187908000-187908022 CCAGATGAGGAATTTCTGTGAGG + Intergenic
986670580 5:10139569-10139591 CCAGATCAGCTGATTCTGTGCGG + Intergenic
987253972 5:16129341-16129363 CATGATTAGCAGTGTTTGTTTGG + Intronic
987857539 5:23440331-23440353 TCTGATTAACAGCTTCTGGGTGG + Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
996399385 5:123045145-123045167 ACTGACTAACAGTGTCTGTGTGG + Intergenic
997170321 5:131712875-131712897 CTAGATGAGCAGTTTCAGTGGGG - Intronic
997842641 5:137256256-137256278 CCTGAATTGCTATTTCTGTGTGG - Intronic
1003052216 6:2790488-2790510 CCTGATTAAAAGTTTCTCAGTGG - Intergenic
1003653505 6:7984787-7984809 GCTGAATTGCAGTGTCTGTGAGG + Intronic
1005416151 6:25602418-25602440 CATGATTAACAGTTTCTTTTTGG + Intronic
1006562940 6:34929380-34929402 CCTGTTTAGCAGTATCTGCCTGG + Intronic
1006577058 6:35054189-35054211 CCAGACTGCCAGTTTCTGTGGGG - Intronic
1007640876 6:43338726-43338748 CCTGGTTAACAGATTCTCTGAGG + Exonic
1010289396 6:74117572-74117594 GCTGATTAGCAGCTGCTATGTGG - Intergenic
1016058878 6:139607617-139607639 GCTGATTGGCAGTTTCTGTGAGG - Intergenic
1018174929 6:161170239-161170261 CTTGTTTAGCAGTCTCTGTAGGG - Intronic
1022545126 7:31180107-31180129 CCTGTCTAGCAGTTTCTCAGTGG + Intergenic
1022842525 7:34178445-34178467 CCTTGATTGCAGTTTCTGTGAGG - Intergenic
1024571084 7:50723381-50723403 AATGATTGGCAGTTTCTTTGTGG - Intronic
1025231327 7:57204912-57204934 CCTGGCTTGCAGTGTCTGTGCGG + Intergenic
1027659426 7:80971188-80971210 CCTGATGAGCAGTTTCATAGTGG - Intergenic
1028089388 7:86679382-86679404 CCTTGTTAGCATTTCCTGTGGGG + Intronic
1028422791 7:90652027-90652049 ACTGGTGAGCAGTGTCTGTGAGG - Intronic
1032780562 7:135162224-135162246 CCTGATGATCAGTTTCTGAGGGG - Intronic
1034050949 7:147983984-147984006 CCTGCTAAGCAGTTTTTTTGTGG - Intronic
1035379471 7:158428413-158428435 TCTCCTTTGCAGTTTCTGTGCGG - Intronic
1036119546 8:6000859-6000881 GCTGTTTAGCAGGTTTTGTGTGG + Intergenic
1039204608 8:35137608-35137630 CCTAATGAGTAGTTTCTGTTTGG + Intergenic
1040046341 8:42967697-42967719 CCAGAATAGCAGCTTCAGTGGGG - Intronic
1045253838 8:100502965-100502987 CCAGATTAGAGGTCTCTGTGTGG + Intergenic
1045329432 8:101142600-101142622 CCTGGGTAGGAGCTTCTGTGTGG - Intergenic
1046483104 8:114849402-114849424 CCTGCTTTCCAGTTTCTATGTGG - Intergenic
1047168726 8:122468425-122468447 CATAATTATCAGTTTCTCTGAGG + Intergenic
1048058140 8:130889032-130889054 GCTGATTTGCAGTGTCTGTAAGG - Intronic
1050874378 9:10615799-10615821 CCTGAATATCAGTTGCTTTGAGG + Intergenic
1053167487 9:35854632-35854654 CCCGATTTGCAGTATCTGAGGGG + Exonic
1054706745 9:68470808-68470830 CTAGATGAGCAGTTTCTCTGTGG + Intronic
1056686369 9:88765867-88765889 CCTGATTAGTTTTTTCTGTATGG - Intergenic
1056750174 9:89344704-89344726 CCTTCTTAGCAGTTGCTGTAGGG + Intronic
1059268234 9:113056053-113056075 TTTGATTAGCAGTATCTTTGAGG - Intronic
1062367128 9:136216128-136216150 CCAGATCAGCAGCTTCTCTGTGG - Intronic
1189084579 X:38008362-38008384 CCTGGTTATCTCTTTCTGTGGGG + Intronic
1190388885 X:49912001-49912023 CCAGCTTAGCAGTTTCTGATGGG + Intergenic
1190897667 X:54637131-54637153 CTTGATTATCAGTTTCTGTAGGG + Intergenic
1193042831 X:77021853-77021875 CCTGATTAGCAATTTCTGATGGG + Intergenic
1195205395 X:102594559-102594581 TCTGAATAGCAAATTCTGTGTGG + Intergenic
1197269961 X:124414525-124414547 CCTTGTTAGCTGTTTCTCTGTGG + Intronic
1197635942 X:128914885-128914907 CCTGATTCTCAGTACCTGTGCGG + Intergenic
1200361943 X:155616420-155616442 TCTAATTAGCAGTCTCTGTTGGG - Intronic