ID: 1149010846

View in Genome Browser
Species Human (GRCh38)
Location 17:51854718-51854740
Sequence CTGTTAGGTCATAAGCCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149010846_1149010853 22 Left 1149010846 17:51854718-51854740 CCACGTGGCTTATGACCTAACAG 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1149010853 17:51854763-51854785 GCTTACTGTGGTGTCCACAGGGG 0: 1
1: 0
2: 0
3: 10
4: 149
1149010846_1149010851 20 Left 1149010846 17:51854718-51854740 CCACGTGGCTTATGACCTAACAG 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1149010851 17:51854761-51854783 AAGCTTACTGTGGTGTCCACAGG 0: 1
1: 0
2: 1
3: 9
4: 103
1149010846_1149010852 21 Left 1149010846 17:51854718-51854740 CCACGTGGCTTATGACCTAACAG 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1149010852 17:51854762-51854784 AGCTTACTGTGGTGTCCACAGGG 0: 1
1: 0
2: 0
3: 14
4: 126
1149010846_1149010850 10 Left 1149010846 17:51854718-51854740 CCACGTGGCTTATGACCTAACAG 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1149010850 17:51854751-51854773 AGCATATTCAAAGCTTACTGTGG 0: 1
1: 0
2: 0
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149010846 Original CRISPR CTGTTAGGTCATAAGCCACG TGG (reversed) Intronic
900298704 1:1965795-1965817 CTGTCAGGGCAAAAGCCACCTGG - Intronic
900584613 1:3426450-3426472 CAGTGAGGTCATAAGCCCAGGGG - Intronic
904290970 1:29485691-29485713 CTGTTGGCTCAGAAGCCAGGAGG - Intergenic
915632599 1:157163807-157163829 CAGTTTGGTCTTCAGCCACGAGG + Intergenic
917721070 1:177787140-177787162 CTGTTAGGTAAGAAGCCTTGAGG - Intergenic
923866271 1:237943051-237943073 CTGTTAGGTCAAAAGGGACTTGG + Intergenic
1063608128 10:7540930-7540952 CTGTTTGGTGATAAGCCATGGGG - Intergenic
1069053523 10:63819517-63819539 ATGTGGGGTCATAAGCCAAGGGG + Intergenic
1070519842 10:77243098-77243120 CTGTCAGGTCAAAAGACAAGGGG + Intronic
1083801512 11:65048732-65048754 CTGTTAGGGCATTATCCACGTGG + Intronic
1084088923 11:66867646-66867668 CTCTCAGGTCCCAAGCCACGTGG - Intronic
1094274629 12:28657999-28658021 CTTTTAGGTCTTAAGACACGTGG + Intergenic
1095923457 12:47554777-47554799 CTGTTGGGTCAGAAGGCATGTGG - Intergenic
1098963447 12:76762850-76762872 CTGTTAGGCCAGAAACCACCAGG - Intergenic
1100947116 12:99798386-99798408 CTGTTTGGTACTTAGCCACGTGG + Intronic
1116831215 14:49721786-49721808 TTGGTAGGTCATTGGCCACGAGG + Intronic
1119260056 14:73232630-73232652 CTGTCAGGAGATAAGCCACCTGG - Intergenic
1127739646 15:61889996-61890018 CTGTTAGTTGAAAAGCCCCGAGG - Intronic
1128729400 15:70010639-70010661 CTGTTAGCTCAGAGGCCATGGGG + Intergenic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1137845915 16:51687926-51687948 CTCTTAGGTCATAAACCAATAGG - Intergenic
1138873455 16:60920887-60920909 CTGCCAGGTCATAAGCAAGGTGG + Intergenic
1139294649 16:65889757-65889779 CTGTTAGGTCAGGAACCACCTGG + Intergenic
1141523658 16:84597967-84597989 CTGCTTGCCCATAAGCCACGAGG + Intronic
1144850426 17:18241366-18241388 CTGTTGGGTCAGCAGCCACGAGG + Intronic
1146374713 17:32286218-32286240 CTGCTAGGTCTTAGGGCACGTGG + Intronic
1149010846 17:51854718-51854740 CTGTTAGGTCATAAGCCACGTGG - Intronic
1155308929 18:24505572-24505594 TGGCTAGGTCATAAGCCACATGG + Intergenic
1155506599 18:26539633-26539655 CTGTAGGGGCATAAGGCACGAGG - Intronic
1162339565 19:10084164-10084186 CTGTTAGGTTATAATCACCGTGG - Intergenic
1165728652 19:38130264-38130286 CTGCAAGGTTAGAAGCCACGGGG + Intronic
1166689609 19:44814525-44814547 ATGCTAGGTCAGAAGCCACCAGG - Intronic
939316452 2:140556428-140556450 CTATTAGATCATAACCCACACGG + Intronic
1169317169 20:4602345-4602367 CTGTTAGTTCCAAAGCCAGGCGG + Intergenic
1169552686 20:6717371-6717393 CTCTTAGGTCAGTAGCCACTGGG + Intergenic
1169619569 20:7490394-7490416 CTGTTAGGTCTAAATCCACATGG - Intergenic
951197087 3:19836348-19836370 CTGTCTGGTGATAAGCCATGGGG - Intergenic
954697247 3:52434472-52434494 CAGTTAGCTCAGAAGCCACCTGG - Exonic
969495592 4:7524395-7524417 CTGTGAGGGGACAAGCCACGCGG + Intronic
980143621 4:128952585-128952607 CTGCTAGAACATAAGCCACAAGG + Intronic
982083184 4:151809766-151809788 CTGTGTGGGCATGAGCCACGTGG + Intergenic
983257501 4:165416785-165416807 CTGTTAGGCCATAAGCTCAGTGG + Intronic
995781315 5:115778635-115778657 TTGTTTGGTCATAAACCACAAGG + Intergenic
1001858518 5:175033212-175033234 CTGCTAGGTCATAAGCTGCATGG - Intergenic
1005070980 6:21861959-21861981 TTGTTAGGTAATAGGCCATGGGG - Intergenic
1006938642 6:37736532-37736554 CTGCTAGGTTATAAGCCCCTGGG - Intergenic
1021161170 7:17274557-17274579 CTGTTAGATTTTAAGCCACTGGG - Intergenic
1027872224 7:83721709-83721731 CTGTAAGGTCATAAACCAAGAGG - Intergenic
1036126994 8:6071982-6072004 GTGTTAGGTCATAAGGGATGTGG - Intergenic
1037415491 8:18645122-18645144 CTGTTAGGTCATAAGGGAAAAGG - Intronic
1038428944 8:27484475-27484497 CTGATAGGTCAGGTGCCACGAGG + Intergenic
1043111813 8:76194596-76194618 CTGTTAGGTCATATGGTAAGTGG - Intergenic
1051525915 9:18044195-18044217 CTGTTTGGTCCTTAGCCACTTGG - Intergenic
1052981482 9:34453121-34453143 CTGCTGGGTCATGAGCCACATGG + Intronic
1058099507 9:100903478-100903500 CTGATAGGTCCTAAGGCACTGGG + Intergenic
1059233149 9:112740083-112740105 CTGTTAGTTCACAAGACAGGTGG + Intergenic
1061001582 9:127905707-127905729 CTGCTATGTCCTAAGCCATGGGG + Intergenic
1190718134 X:53121664-53121686 CTGTTAGGTCATAAAAAACAAGG - Intergenic
1194633424 X:96315021-96315043 CTGGTAAGTCCTAAGCCAAGGGG + Intergenic