ID: 1149013292

View in Genome Browser
Species Human (GRCh38)
Location 17:51880204-51880226
Sequence CAGGAGGAATAAAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3660
Summary {0: 1, 1: 0, 2: 19, 3: 309, 4: 3331}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149013292_1149013301 3 Left 1149013292 17:51880204-51880226 CCCTCCTCCCTTTATTCCTCCTG 0: 1
1: 0
2: 19
3: 309
4: 3331
Right 1149013301 17:51880230-51880252 AACCCTGGTATGTCCCCGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 83
1149013292_1149013307 18 Left 1149013292 17:51880204-51880226 CCCTCCTCCCTTTATTCCTCCTG 0: 1
1: 0
2: 19
3: 309
4: 3331
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149013292 Original CRISPR CAGGAGGAATAAAGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr