ID: 1149013301

View in Genome Browser
Species Human (GRCh38)
Location 17:51880230-51880252
Sequence AACCCTGGTATGTCCCCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 83}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149013291_1149013301 11 Left 1149013291 17:51880196-51880218 CCATAGTTCCCTCCTCCCTTTAT 0: 1
1: 0
2: 3
3: 46
4: 775
Right 1149013301 17:51880230-51880252 AACCCTGGTATGTCCCCGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 83
1149013290_1149013301 12 Left 1149013290 17:51880195-51880217 CCCATAGTTCCCTCCTCCCTTTA 0: 1
1: 0
2: 0
3: 13
4: 233
Right 1149013301 17:51880230-51880252 AACCCTGGTATGTCCCCGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 83
1149013296_1149013301 -5 Left 1149013296 17:51880212-51880234 CCTTTATTCCTCCTGACCAACCC 0: 1
1: 0
2: 0
3: 28
4: 224
Right 1149013301 17:51880230-51880252 AACCCTGGTATGTCCCCGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 83
1149013294_1149013301 -1 Left 1149013294 17:51880208-51880230 CCTCCCTTTATTCCTCCTGACCA 0: 1
1: 0
2: 0
3: 22
4: 308
Right 1149013301 17:51880230-51880252 AACCCTGGTATGTCCCCGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 83
1149013295_1149013301 -4 Left 1149013295 17:51880211-51880233 CCCTTTATTCCTCCTGACCAACC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 1149013301 17:51880230-51880252 AACCCTGGTATGTCCCCGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 83
1149013292_1149013301 3 Left 1149013292 17:51880204-51880226 CCCTCCTCCCTTTATTCCTCCTG 0: 1
1: 0
2: 19
3: 309
4: 3331
Right 1149013301 17:51880230-51880252 AACCCTGGTATGTCCCCGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 83
1149013289_1149013301 13 Left 1149013289 17:51880194-51880216 CCCCATAGTTCCCTCCTCCCTTT 0: 1
1: 0
2: 17
3: 188
4: 758
Right 1149013301 17:51880230-51880252 AACCCTGGTATGTCCCCGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 83
1149013288_1149013301 29 Left 1149013288 17:51880178-51880200 CCGTAATAAGGCTCTTCCCCATA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1149013301 17:51880230-51880252 AACCCTGGTATGTCCCCGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 83
1149013293_1149013301 2 Left 1149013293 17:51880205-51880227 CCTCCTCCCTTTATTCCTCCTGA 0: 1
1: 0
2: 5
3: 85
4: 822
Right 1149013301 17:51880230-51880252 AACCCTGGTATGTCCCCGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149013301 Original CRISPR AACCCTGGTATGTCCCCGTG TGG Intronic
900226398 1:1535335-1535357 GGCCCCGGTAAGTCCCCGTGCGG + Exonic
900609531 1:3538645-3538667 AGGCCTGGTCTGTCCCCGTGAGG + Intronic
900927725 1:5716631-5716653 AGCCCTGGTGCTTCCCCGTGTGG - Intergenic
901207581 1:7505710-7505732 AACCTTGGAATGTCCTCGGGTGG + Intronic
911243511 1:95491254-95491276 AACCCTGGTATGTCCCACACTGG - Intergenic
912686890 1:111774935-111774957 AACTCTGGTATGTGCCAGTGAGG - Intronic
921060190 1:211578754-211578776 GACCCGGGCTTGTCCCCGTGCGG - Intergenic
923078267 1:230629502-230629524 AACCCTGGTGCTTCCCCATGTGG + Intergenic
1072363961 10:94690026-94690048 AACCCTGGTACTTCCCCATGTGG + Intronic
1074664506 10:115704431-115704453 AACCCTCGTATGTCAGAGTGGGG - Intronic
1076271345 10:129155025-129155047 GAGCCTGGAATGTCCCTGTGGGG + Intergenic
1076346345 10:129781288-129781310 AACCTGGGTATGGCCTCGTGAGG - Intergenic
1076698540 10:132258422-132258444 AGCCCTGGAAGGGCCCCGTGGGG - Intronic
1077315521 11:1917829-1917851 AACCCTGCACTGGCCCCGTGTGG - Intergenic
1079101232 11:17543621-17543643 CACCCTGGTGTGTCCCAGTGAGG - Intronic
1081743626 11:45457961-45457983 AACCCTGGTGTTTCCCCATGTGG - Intergenic
1082262517 11:50088151-50088173 AACCCTGTTATGTGCATGTGAGG - Intergenic
1089139779 11:116276172-116276194 CACCCTGGGCTGTCCCCGAGGGG - Intergenic
1091109032 11:132948248-132948270 AACCCTGGTGCCTCCCCATGTGG - Intronic
1095391625 12:41714085-41714107 AACCATGCTATGTCCCCCAGTGG - Intergenic
1096750229 12:53753954-53753976 GGCCCTGATATGTCCTCGTGGGG + Intergenic
1100901816 12:99250041-99250063 GACCCTGGTAGTTCCCTGTGTGG - Intronic
1102467436 12:113138060-113138082 ATCCTTGGTATTTCCCCGTGGGG - Intergenic
1102559029 12:113749027-113749049 AACCCTAGAATGTCCCCTGGAGG + Intergenic
1110370019 13:74729440-74729462 AACTCTGGTTTGTCCTCTTGAGG + Intergenic
1111488471 13:88937228-88937250 AACCCTTGTATGATCCAGTGGGG + Intergenic
1115129491 14:30037629-30037651 AACCCTGGTGCTTCCCTGTGTGG - Intronic
1115369312 14:32593912-32593934 AAACCTGGTATCTGCCCTTGAGG + Intronic
1121108685 14:91297239-91297261 AGCCCTGGGCTGTCCCCTTGGGG + Intronic
1122105081 14:99446855-99446877 TACACTGGTGTGTCCCCCTGAGG - Intronic
1144040211 17:11403881-11403903 AGCCCAGGCATGTCCCCATGGGG + Intronic
1144194411 17:12876351-12876373 AGCCCTGGTGTGTCCCCATGTGG + Intronic
1149013301 17:51880230-51880252 AACCCTGGTATGTCCCCGTGTGG + Intronic
1149478391 17:56982500-56982522 AACCCTTGTATGTCAGCCTGGGG + Intronic
1150483446 17:65528151-65528173 AGACCTGGAATGTCCACGTGGGG - Intergenic
1152035135 17:77867670-77867692 AGCCCTGGTGCTTCCCCGTGTGG + Intergenic
1153859906 18:9192027-9192049 CACCCTGGTACTTCCCTGTGTGG + Intronic
1155365786 18:25047903-25047925 AACCCTGGTGCTTCCCCATGTGG - Intergenic
1159745996 18:72235546-72235568 AACCCTGTTCTGTCCCCTTCAGG - Intergenic
1161265272 19:3360807-3360829 GACCGTGGGGTGTCCCCGTGTGG + Intronic
1165874012 19:38992961-38992983 TACCCTGGTGAGTCCCTGTGTGG - Intronic
1167147763 19:47693514-47693536 AACCCAGGCCTGTCCCTGTGTGG + Intronic
1167592027 19:50409299-50409321 AGCCCTGGGGTGTCCCAGTGAGG - Intronic
929040337 2:37738393-37738415 AACCCTGGTGCTTCCCCGTGTGG - Intronic
930832476 2:55759715-55759737 AACCCTGGTGCTTCCCTGTGTGG + Intergenic
934571330 2:95374936-95374958 AGCCCTGCTGTGTCCCAGTGTGG + Intronic
937887512 2:126909982-126910004 AACCCTGGTGCATCCCCATGTGG + Intergenic
938787163 2:134640654-134640676 AACCAGGGTTTGTCCCCCTGGGG - Intronic
945391248 2:209267560-209267582 GACCCTGGTTTATCCCCATGTGG + Intergenic
1173305571 20:41844859-41844881 AACTCTGGAATGTCTCCTTGTGG + Intergenic
1174415383 20:50362969-50362991 TACCCTGGTATGTCCCTGGTGGG - Intergenic
1181033219 22:20158045-20158067 ACCTCTGGTGTGTCCCCTTGAGG - Intergenic
1181510086 22:23385187-23385209 ACCTCTGGTGTGTCCCCTTGAGG + Intergenic
1181550036 22:23632615-23632637 AACCCTGGTATGGCCGGGAGTGG + Intergenic
1203292608 22_KI270736v1_random:9935-9957 AACGCTGGTGCTTCCCCGTGTGG - Intergenic
950390656 3:12694005-12694027 AGCCCTGGCATCTCTCCGTGGGG - Intergenic
952319509 3:32262909-32262931 AACCCTAGTATGTACCAGAGAGG - Intronic
954470453 3:50689840-50689862 AACCCTGCTTTATCCCCGTTAGG - Intronic
960378844 3:116935364-116935386 GACCCTGGTATGTCACGTTGAGG - Intronic
961006091 3:123406326-123406348 GACCCTGGCATTTCCCCGTGTGG + Intronic
961490571 3:127254268-127254290 AACCCAGGAAGGTCCACGTGGGG - Intergenic
964075607 3:152688352-152688374 TTCCCTGGTATGTTCCTGTGTGG - Intergenic
966785719 3:183620963-183620985 AACCCTGGTACTTCCCCATGTGG - Intergenic
969558106 4:7927126-7927148 AACCCTGGTAGGACCTCTTGAGG - Intronic
975640381 4:76494346-76494368 TACCCTGGTATGTAGCTGTGTGG + Intronic
985122276 4:186656045-186656067 AACCCTGGCATGGTCCCGTATGG - Intronic
998857282 5:146405600-146405622 AACCCTGGTGCTTCCCCATGTGG - Intergenic
1001236217 5:170031846-170031868 AACCCTGGTTTCTCCAAGTGTGG + Intronic
1002162046 5:177320110-177320132 AACACTGGTGCTTCCCCGTGTGG + Intergenic
1005012408 6:21348480-21348502 ATCCCTGGTATGTGCCAGGGAGG + Intergenic
1014696506 6:124627814-124627836 CTCCCTGGAATGTCGCCGTGGGG - Intronic
1017140394 6:151184513-151184535 AACCCTGGCATTTCCCTGTGTGG + Intergenic
1017834194 6:158162033-158162055 GACCCTGGTACTTCCCCATGTGG + Intronic
1019282530 7:207676-207698 GTCCCTGGTGTGGCCCCGTGAGG + Intronic
1021966664 7:25926921-25926943 AGCCCTGGTGCTTCCCCGTGTGG - Intergenic
1023177407 7:37448014-37448036 GACCCCGGTGTGTCCCCGGGAGG + Intronic
1023907441 7:44532327-44532349 CACACTGGTATGTCTCCATGAGG - Intronic
1024743655 7:52382868-52382890 AATCCTGGTATGCCACTGTGAGG - Intergenic
1024867476 7:53920447-53920469 AACCCTGTTATGTCACCCAGTGG - Intergenic
1025184696 7:56848612-56848634 AACCCTGTTATGTGCATGTGAGG - Intergenic
1025687234 7:63728350-63728372 AACCCTGTTATGTGCATGTGAGG + Intergenic
1026598690 7:71755016-71755038 GGCCCTGGAATGTCCTCGTGAGG - Intergenic
1031454154 7:121958708-121958730 CACTCAGGTATGTCCCCGTCGGG + Intronic
1034587562 7:152108550-152108572 AGCCCTGGGAGGGCCCCGTGTGG + Intronic
1034710814 7:153189940-153189962 AACCCTGGTGCTTCCCCATGTGG + Intergenic
1040010427 8:42656945-42656967 AACGCAGGGATGGCCCCGTGAGG - Intergenic
1044008048 8:86961600-86961622 TCCCCTGGGATGTCCCCCTGTGG + Intronic
1049018979 8:139941013-139941035 ACCCCAGGTATGTCCCAGTGAGG - Intronic
1051119337 9:13734833-13734855 AACCTTGCAATGTCCCTGTGAGG - Intergenic
1054907790 9:70425821-70425843 AGCCCTGGTATGTTCTCATGAGG + Intergenic
1057184372 9:93048689-93048711 AACCCTGGTGCTTCCCTGTGTGG - Intergenic
1057444921 9:95107050-95107072 CACCCTGGTAAGTCTCCCTGTGG - Exonic
1057832277 9:98416604-98416626 AGCCCTGCTATGTCCCTTTGAGG + Intronic
1061101474 9:128495823-128495845 AAACCTGGTTTCTCCCAGTGTGG + Intronic
1188113733 X:26220206-26220228 AACCCTTGTGTGACCCTGTGTGG + Intergenic
1193838221 X:86373435-86373457 AACCTTATTATGTCCCCATGAGG + Intronic