ID: 1149013307

View in Genome Browser
Species Human (GRCh38)
Location 17:51880245-51880267
Sequence CCGTGTGGTACTGAGTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149013290_1149013307 27 Left 1149013290 17:51880195-51880217 CCCATAGTTCCCTCCTCCCTTTA 0: 1
1: 0
2: 0
3: 13
4: 233
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1149013293_1149013307 17 Left 1149013293 17:51880205-51880227 CCTCCTCCCTTTATTCCTCCTGA 0: 1
1: 0
2: 5
3: 85
4: 822
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1149013291_1149013307 26 Left 1149013291 17:51880196-51880218 CCATAGTTCCCTCCTCCCTTTAT 0: 1
1: 0
2: 3
3: 46
4: 775
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1149013289_1149013307 28 Left 1149013289 17:51880194-51880216 CCCCATAGTTCCCTCCTCCCTTT 0: 1
1: 0
2: 17
3: 188
4: 758
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1149013292_1149013307 18 Left 1149013292 17:51880204-51880226 CCCTCCTCCCTTTATTCCTCCTG 0: 1
1: 0
2: 19
3: 309
4: 3331
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1149013299_1149013307 -1 Left 1149013299 17:51880223-51880245 CCTGACCAACCCTGGTATGTCCC 0: 1
1: 0
2: 5
3: 26
4: 143
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1149013300_1149013307 -6 Left 1149013300 17:51880228-51880250 CCAACCCTGGTATGTCCCCGTGT 0: 1
1: 0
2: 0
3: 14
4: 109
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1149013295_1149013307 11 Left 1149013295 17:51880211-51880233 CCCTTTATTCCTCCTGACCAACC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1149013298_1149013307 2 Left 1149013298 17:51880220-51880242 CCTCCTGACCAACCCTGGTATGT 0: 1
1: 0
2: 10
3: 126
4: 688
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1149013294_1149013307 14 Left 1149013294 17:51880208-51880230 CCTCCCTTTATTCCTCCTGACCA 0: 1
1: 0
2: 0
3: 22
4: 308
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1149013302_1149013307 -10 Left 1149013302 17:51880232-51880254 CCCTGGTATGTCCCCGTGTGGTA 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1149013296_1149013307 10 Left 1149013296 17:51880212-51880234 CCTTTATTCCTCCTGACCAACCC 0: 1
1: 0
2: 0
3: 28
4: 224
Right 1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149013307 Original CRISPR CCGTGTGGTACTGAGTAGAT TGG Intronic
910616274 1:89201890-89201912 CTGGGTACTACTGAGTAGATTGG - Intergenic
912651198 1:111441225-111441247 GCAAGTGTTACTGAGTAGATTGG - Exonic
916902736 1:169247169-169247191 AAGTACGGTACTGAGTAGATAGG + Intronic
920020943 1:202956259-202956281 CTGTGTGATAATAAGTAGATGGG + Intronic
921516463 1:216098159-216098181 ACGTGGGATACTGAGTAGAGTGG - Intronic
1065543235 10:26791389-26791411 ATGTGTGGTTGTGAGTAGATGGG - Intronic
1065897130 10:30173398-30173420 CTGTGTGGTTCTGTGTAGGTGGG - Intergenic
1070659295 10:78293309-78293331 TCCTGGGGCACTGAGTAGATTGG + Intergenic
1075027259 10:118994489-118994511 CTCTGAGGTACTGAGTAGCTTGG + Intergenic
1076770956 10:132664509-132664531 CAGTGTGTTCCTGAGCAGATGGG + Intronic
1080954281 11:37074986-37075008 CCATGTGATGCTGAGAAGATAGG + Intergenic
1084653948 11:70504522-70504544 CCGGGTGGGTCTGAGTACATGGG - Intronic
1089570337 11:119403831-119403853 CCATGTGGAACTGACCAGATCGG + Intergenic
1089582501 11:119490074-119490096 CAGTGTGGTAATGAGTTGGTTGG - Intergenic
1094132946 12:27094539-27094561 GCCTGTGGTACTGAAAAGATGGG - Intergenic
1098187966 12:67918690-67918712 ACGTGTGCTACTGAGTAGCAAGG + Intergenic
1101079528 12:101169042-101169064 GGATGTGGTACTGAGTAGAGAGG + Intronic
1101418196 12:104526989-104527011 CCGTGTGGTGCTGAGGAGAATGG - Intronic
1117232861 14:53739617-53739639 CCTTGTGGTACTGAAAAGATTGG - Intergenic
1118625294 14:67653299-67653321 CTGGGTGGTACTGAGTATACAGG + Intronic
1123754723 15:23388198-23388220 TCCTGTGGTCCTGAGTAGCTGGG - Intergenic
1132803497 16:1765389-1765411 GCGTGGGGTCCTGAGTAGGTAGG - Intronic
1135821194 16:25688078-25688100 ACGTGCGGGATTGAGTAGATGGG + Intergenic
1140621117 16:76734226-76734248 CTGTGTGGGAGTGAGTAGAAAGG - Intergenic
1144764009 17:17723210-17723232 CCGTGAGGTACTGCGTGGGTGGG - Intronic
1149013307 17:51880245-51880267 CCGTGTGGTACTGAGTAGATTGG + Intronic
1150594824 17:66594723-66594745 CCGTGTGGTAGAGAGGAGCTGGG - Intronic
1164211947 19:23106294-23106316 CTGTGTGGTACTCTGAAGATGGG + Intronic
1168648657 19:58078385-58078407 CCGTGGTGTACTGAATAGCTGGG - Intronic
928132823 2:28665495-28665517 ACTTGTGGTACAGAGTGGATGGG + Intergenic
932449876 2:71802582-71802604 CAGTGTAGAACTGAGTAGGTTGG - Intergenic
1171981779 20:31633619-31633641 CCCTGTGAAACTGAGGAGATGGG + Intergenic
1178267171 21:31154342-31154364 CCGTGGAGTCCTGAGGAGATGGG + Exonic
1178897951 21:36576210-36576232 ATGTGTTGTAATGAGTAGATTGG - Intronic
1179229504 21:39488779-39488801 CTGTGTGGTGCTGAGTAGCTGGG + Intronic
1181781797 22:25199167-25199189 CTGTGTGATTCTGAGTAAATGGG + Intergenic
1183932441 22:41243559-41243581 CGGTGTGGTACCGAGAAGGTAGG - Intergenic
950519853 3:13491637-13491659 GCTTGTGGAGCTGAGTAGATGGG + Intronic
957333347 3:78794696-78794718 CCATGTGCTACCGAGTAGCTAGG + Intronic
957782222 3:84834406-84834428 CCGTGTGGGTGTCAGTAGATGGG + Intergenic
963950750 3:151197506-151197528 CTGGGTGGCACTGAGTAGCTCGG + Intronic
972645534 4:40964569-40964591 CCCTGTGGTACTGGGAAAATGGG + Intronic
976296372 4:83476519-83476541 CATGGTGGTACTGAGTAGAATGG - Intronic
979665727 4:123308941-123308963 CCTTGTGTTTCTGAGAAGATGGG - Intronic
988976618 5:36522408-36522430 GAATGTGGTTCTGAGTAGATGGG + Intergenic
989512961 5:42309614-42309636 CTGTGTGCTAATGAGAAGATTGG - Intergenic
990835450 5:60014272-60014294 CCATGTGGTATTGATTAGGTAGG - Intronic
998793645 5:145793740-145793762 TCGTGTGGGAATGAGTAGAAAGG - Intronic
1006611095 6:35295023-35295045 GCGTGTGGCACTGGGTAGATGGG + Intronic
1016396548 6:143629450-143629472 CCGTGAGGTACTGGTTAGTTTGG - Intronic
1017346463 6:153388339-153388361 CAGTGTGGCACTGAGGAAATTGG + Intergenic
1018094655 6:160374689-160374711 CCCTGTGGTGCTGAGGAGGTGGG - Intronic
1022332681 7:29395405-29395427 ACCTGTGGTCCTGAGTAGCTGGG - Intronic
1023872689 7:44271386-44271408 CTGTGTGGCACTGAGCAGCTCGG + Intronic
1024012221 7:45278625-45278647 CTGTGTGGCACAGAGTAGCTAGG + Intergenic
1031541407 7:122999204-122999226 GCATGTGGTACTGAGCAGGTGGG + Intergenic
1032274539 7:130442604-130442626 ACTTGAGGAACTGAGTAGATGGG + Intergenic
1046023527 8:108695167-108695189 ACTTCTGGTACTGAGAAGATTGG - Intronic
1055003807 9:71483357-71483379 CAGTGTGATACTCAGCAGATTGG - Intergenic
1055711872 9:79072171-79072193 ATCTGTAGTACTGAGTAGATAGG + Intergenic
1062194074 9:135263725-135263747 CTGTGTGGATCTGAGTAGAAGGG - Intergenic
1189621382 X:42843652-42843674 CTATGTGGAACTGAGGAGATGGG + Intergenic
1192259471 X:69495887-69495909 CCATCTGGTAATGGGTAGATGGG - Intergenic