ID: 1149015828

View in Genome Browser
Species Human (GRCh38)
Location 17:51907360-51907382
Sequence AGCCGGGAAGGCCCCACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149015828_1149015834 2 Left 1149015828 17:51907360-51907382 CCTTCAGTGGGGCCTTCCCGGCT 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1149015834 17:51907385-51907407 CCCATCTAAAATAGCAACCCTGG 0: 1
1: 0
2: 0
3: 12
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149015828 Original CRISPR AGCCGGGAAGGCCCCACTGA AGG (reversed) Intronic
900584460 1:3425788-3425810 ACACGGGCAGGCCCCACAGAGGG + Intronic
900841175 1:5049771-5049793 AGGCGGGAAGGCCAAACCGAGGG - Intergenic
900919936 1:5663644-5663666 AGGCTGGAAGTCCACACTGAAGG + Intergenic
900964007 1:5944915-5944937 AGCCGAGATCGCGCCACTGAGGG + Intronic
900975651 1:6014699-6014721 AGCAGGGAAGGTAGCACTGAGGG + Intronic
901004050 1:6163183-6163205 AGCAGGGAAGGGGCCACAGATGG - Intronic
901443943 1:9295551-9295573 AGCCCAGAGGGACCCACTGAAGG - Intronic
903534813 1:24059943-24059965 GGAGGGGAAGGCCCCACAGATGG + Intronic
904304663 1:29580389-29580411 AGCAAGGAAGGCCCCAGTGTGGG - Intergenic
905310114 1:37043183-37043205 AGCTGGGATGGGGCCACTGATGG + Intergenic
912124940 1:106524372-106524394 AGCCAGGAAGTCACCACTGTGGG - Intergenic
912692348 1:111813743-111813765 AGCCAGGCAGGCCTCACTGGTGG + Intronic
915512359 1:156393100-156393122 AGTCTGGCAGGCCACACTGATGG - Intergenic
918200576 1:182262525-182262547 ACCAGGTAAGGCCCCACTGAGGG + Intergenic
923134687 1:231107563-231107585 AGCCGGGAAAGGGACACTGATGG - Intergenic
924852628 1:247845637-247845659 AGATGGGAAGGCTGCACTGAGGG - Intergenic
1063464369 10:6233321-6233343 AGCTGGGAAGACCACACTGGTGG + Exonic
1069642935 10:69968030-69968052 AGCCGGGAAGGCCTCACGTTGGG - Intergenic
1070744722 10:78926899-78926921 AGCCTTGAAGGCCCCACTCGGGG - Intergenic
1071530939 10:86389936-86389958 AGCCGGGTGGGCCGCAGTGATGG - Intergenic
1072902264 10:99419022-99419044 AGCAGGGAAGGCCCTGGTGAAGG - Intronic
1073119130 10:101110989-101111011 AGCCAGGAGGGAACCACTGAGGG + Intronic
1073533550 10:104254771-104254793 AGCCGGGAAGGCACAACGGGTGG + Exonic
1075040641 10:119104410-119104432 GGCCGGGCAGGCCCCACAGGCGG - Intronic
1077998339 11:7473283-7473305 AGCCAGAAAAGGCCCACTGAGGG - Intergenic
1079105976 11:17572694-17572716 AGTCAGGAAGGCCTCAGTGAGGG - Intronic
1079690119 11:23406711-23406733 AGTTGGGAAGGCCCCTCTGGGGG - Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1083842631 11:65313591-65313613 AGCCGGGAAGACCTCAGTGGGGG - Intergenic
1084492922 11:69488141-69488163 AGGATGGAAGGCCCCACTGCCGG - Intergenic
1084694258 11:70744422-70744444 AGCCTGCCAGGCCCCACTGCAGG - Intronic
1089819763 11:121213722-121213744 GGCAGGGCAGGCCACACTGAAGG - Intergenic
1090479461 11:127055432-127055454 AGCCGGGAAGGCTCCTGGGAAGG - Intergenic
1090703285 11:129315093-129315115 AGCAGGCTAGGACCCACTGATGG - Intergenic
1090834571 11:130444908-130444930 GTCTGGGAAGGCCCCTCTGAGGG + Intergenic
1091106124 11:132921361-132921383 GGCCTGGAAGGGCCCACTGTGGG - Intronic
1091297887 11:134486586-134486608 GGCGGGGAAGGCCCCAGCGAGGG - Intergenic
1092100046 12:5875549-5875571 AGCCTGGAAGCTCCCACAGATGG - Intronic
1095946763 12:47758238-47758260 AGACCGGCAGGCCCCAGTGAAGG - Intronic
1097022716 12:56032212-56032234 AGACAGGCAGGCCCCACTGCAGG - Intronic
1102991505 12:117319557-117319579 AGCTGGGAAGGGGCCACTGCGGG - Intronic
1103614738 12:122145040-122145062 AGCGGGGCAGGCGCCACTGAGGG + Exonic
1104083751 12:125456525-125456547 AGCAGGCAAAGCCCCACAGAGGG - Intronic
1108162654 13:47658129-47658151 AGACAGGAAGGCCCCAGAGAAGG - Intergenic
1112009522 13:95282326-95282348 AGACAGGAAAGTCCCACTGAAGG + Intronic
1120510809 14:85412209-85412231 ATCCTGGAAGGGCACACTGATGG + Intergenic
1122784826 14:104158781-104158803 TGCCGGGAAGGGCCCAGTGGAGG - Intronic
1125716363 15:41822089-41822111 AGCCCGGAGCACCCCACTGAAGG + Exonic
1125721629 15:41847841-41847863 GGCAGCGCAGGCCCCACTGATGG + Exonic
1126611005 15:50529433-50529455 AGCTGGGATTGCACCACTGATGG + Intronic
1128455248 15:67828163-67828185 AGGTGGGAAGGCGCCACTGGCGG - Intronic
1129110875 15:73336304-73336326 AGCCAGGGAGACCCCACTCAGGG - Intronic
1129521660 15:76190177-76190199 GTCAGGGAAGGCCCCTCTGAGGG + Intronic
1130996768 15:88908509-88908531 AGCTGCGAAGGTCCCTCTGAGGG + Intronic
1132703121 16:1230348-1230370 TGCCAGGCAGGCCCCGCTGAGGG + Intergenic
1132705200 16:1240520-1240542 TGCCAGGCAGGCCCCGCTGAGGG - Intergenic
1132746417 16:1438201-1438223 AGGTGGGCAGGCTCCACTGAGGG - Intronic
1135229495 16:20692363-20692385 AGCCTGGAAGCCCCCACTTTAGG - Intronic
1136186191 16:28590304-28590326 GGCAGGGATGGCCCCACAGAGGG - Exonic
1136318008 16:29465511-29465533 GGCAGGGATGGCCCCACAGAGGG + Exonic
1136432583 16:30204860-30204882 GGCAGGGATGGCCCCACAGAGGG + Exonic
1138437713 16:57014779-57014801 AGCCGGGAAGTCCCCAATCAGGG + Intronic
1139708944 16:68761670-68761692 ATCTGAGAAGGCCTCACTGAAGG + Intronic
1142184589 16:88688533-88688555 ACCCAAGAAGGCCCCACAGAGGG + Intergenic
1142347892 16:89565644-89565666 AGTCAGGACGGCCCCACTCAGGG - Exonic
1144104150 17:11971157-11971179 AGATGAGAAGGCCCCACTTAGGG - Intergenic
1148732086 17:49843456-49843478 AGCATGGAAGGCACCACTCAGGG + Intronic
1149015828 17:51907360-51907382 AGCCGGGAAGGCCCCACTGAAGG - Intronic
1149535051 17:57427010-57427032 AGCCGGGGTGCCCCCACGGAAGG + Intronic
1150288245 17:63966150-63966172 AGCCAAGAAGGCCCAGCTGAAGG + Exonic
1151628728 17:75295240-75295262 AGCCCGGAAGACCACAGTGAGGG - Intergenic
1152468876 17:80480047-80480069 AGCCGGCCAGTACCCACTGATGG - Intergenic
1154338629 18:13485331-13485353 AGCCAGGAAGGCCTGAGTGAGGG + Intronic
1160578797 18:79871980-79872002 AGGCGGGCAGGGCCCAGTGATGG + Intronic
1161401668 19:4068375-4068397 ACCCGGGAGGGCCCCCCGGAGGG + Intergenic
1163152247 19:15422444-15422466 AGCTGGGAAGGCCCCTCTCGGGG + Exonic
1163311735 19:16519099-16519121 AGCCAGGAAGGTCCCACAGCCGG + Exonic
1163554615 19:17984923-17984945 AGCCAGCAAGGCCCCAAGGAGGG - Intronic
1164677794 19:30113373-30113395 AGCAGGGAAGGCCCCTCCCATGG - Intergenic
1166840978 19:45696822-45696844 GGCCGGGAAGGCCTCTTTGAAGG - Intronic
929605916 2:43234065-43234087 TACTGGGATGGCCCCACTGAGGG + Intronic
932457405 2:71858273-71858295 AGCTGGGAAGGCCCCAGGCAGGG - Intergenic
936271756 2:111054512-111054534 CCCCAGGAAGGCTCCACTGATGG + Intronic
938699410 2:133862855-133862877 AGCTGGAAAGGCCTCACTGAGGG - Intergenic
939562027 2:143743420-143743442 TGTAGGGAAGGCCCTACTGATGG + Intronic
941642052 2:167999210-167999232 AGCAGGGGAAGCCCCTCTGAGGG - Intronic
944529762 2:200655784-200655806 AGCTTGGAAGGCCCTTCTGATGG + Intronic
948380327 2:237546099-237546121 AACCAGGAAGCCCCCACTTAAGG - Intronic
948459104 2:238120607-238120629 AGCCGGGAAGGCCCCGGGGTTGG - Intronic
948494352 2:238337264-238337286 AGCAGGGAGGGCCTCTCTGAGGG + Intronic
948797504 2:240412420-240412442 AGCCCTGGAGGCCCCACTGGGGG + Intergenic
948806254 2:240454496-240454518 AGCCAGGAAGGCCCCGTTGCCGG + Intronic
1169189051 20:3645640-3645662 AGCAAGGACGGCCCCACTGTTGG - Intronic
1175443580 20:59006550-59006572 AGGCGGGAGGGCCCTACCGAGGG - Intronic
1175966812 20:62664072-62664094 AGCTGGGAAGGCCCCACATCAGG - Intronic
1175995225 20:62809307-62809329 AGCCCGGAAGGTCCCTCTGGGGG - Intronic
1176152245 20:63597797-63597819 GGCCGGGAAGTCCACCCTGAAGG - Exonic
1176550802 21:8220235-8220257 AGCCGAGAAGGCACCAAGGAAGG - Intergenic
1176550915 21:8220967-8220989 AGCCGAGAAGGCACCAAGGAAGG - Intergenic
1176551013 21:8221529-8221551 AGCCGAGAAGGCACCAAGGAGGG - Intergenic
1176569600 21:8402502-8402524 AGCCGAGAAGGCACCAAGGAAGG - Intergenic
1176569714 21:8403234-8403256 AGCCGAGAAGGCACCAAGGAAGG - Intergenic
1176569824 21:8403966-8403988 AGCCGAGAAGGCACCAAGGAAGG - Intergenic
1176569922 21:8404528-8404550 AGCCGAGAAGGCACCAAGGAGGG - Intergenic
1176577625 21:8447441-8447463 AGCCGAGAAGGCACCAAGGAAGG - Intergenic
1176577735 21:8448173-8448195 AGCCGAGAAGGCACCAAGGAAGG - Intergenic
1176577833 21:8448735-8448757 AGCCGAGAAGGCACCAAGGAGGG - Intergenic
1180222793 21:46370041-46370063 AGCCGGGGAGGCACCCCTGTGGG - Intronic
1180256856 21:46635619-46635641 AGCCGGGAAGGCCCCGCCCAGGG - Intronic
1184507573 22:44913729-44913751 AGCGGGGATGGCCTCACTGTGGG - Intronic
1203255705 22_KI270733v1_random:136559-136581 AGCCGAGAAGGCACCAAGGAAGG - Intergenic
1203255815 22_KI270733v1_random:137244-137266 AGCCGAGAAGGCACCAAGGAAGG - Intergenic
1203255924 22_KI270733v1_random:137934-137956 AGCCGAGAAGGCACCAAGGAAGG - Intergenic
1203256022 22_KI270733v1_random:138481-138503 AGCCGAGAAGGCACCAAGGAGGG - Intergenic
950906031 3:16539044-16539066 TGCCAGGAAGCCACCACTGATGG - Intergenic
958004391 3:87793168-87793190 AGCCGGCGAGACCCCACTTAGGG + Intergenic
960753163 3:120979197-120979219 AGCCGGGAAGCTCCAACTGGGGG - Intronic
961441641 3:126957096-126957118 AGACAGGAAAGCCCCACTGGAGG - Intronic
961513739 3:127420184-127420206 AGCTGGGAAGGCCAGACTGTGGG - Intergenic
961516756 3:127442791-127442813 AGCCAGGAAGCCCCCAGGGAGGG - Intergenic
964457741 3:156886392-156886414 AGCCCAGGAGGCGCCACTGATGG - Intronic
965955612 3:174365312-174365334 AGTAGGGAAGGCCCCTCTGAGGG + Intergenic
987379557 5:17272344-17272366 AGGCAGGAAGGCACCACAGAGGG - Intronic
988484226 5:31655073-31655095 AGCACGGAAGACTCCACTGATGG - Intronic
990447543 5:55906537-55906559 ATCCGGGAAGGACTCTCTGATGG - Intronic
996738265 5:126776905-126776927 AGCCGGGAGGGCCGAGCTGACGG + Intronic
1000158647 5:158577517-158577539 AGCCGGGAAGCTCCAACTGGGGG - Intergenic
1006131094 6:31870018-31870040 AGTGGGGCAGGCCCCAGTGAGGG - Intronic
1007274242 6:40661759-40661781 AGCAGGAAAGGCCCCACTGGGGG - Intergenic
1019552895 7:1612071-1612093 AGCTGGGAAAACCCCACGGAAGG + Intergenic
1023841925 7:44103011-44103033 AGCCGGGGAGGCCACAGTGGAGG - Intergenic
1023863738 7:44229239-44229261 ACCCTGGAAAGCCCCAGTGAGGG + Intronic
1027757939 7:82239778-82239800 AGGCTGGAAGGCCCCATTGGAGG + Intronic
1029371924 7:100155692-100155714 AGCCTGGAAGGCCACACTGAAGG + Exonic
1030496961 7:110312293-110312315 ATCAGGGAAGGCCTCACTGAGGG - Intergenic
1031141172 7:117945295-117945317 ACCTGTGAAAGCCCCACTGAGGG + Intergenic
1034832581 7:154322117-154322139 AGCCTGGAAAGGCCCACGGAAGG + Intronic
1035301677 7:157901694-157901716 GGACGGGAAGGCCCCACTTCGGG - Intronic
1036641895 8:10590004-10590026 GGCAGGGATGGCCACACTGAGGG - Intergenic
1038311772 8:26450258-26450280 AGCCGGGAAGGCCTCAGGCAGGG + Intronic
1039464923 8:37778065-37778087 AGACGTGAAGGCCCCGCTGGAGG + Exonic
1042618964 8:70683538-70683560 AGCTGGGAAGGCGCCACTGCAGG - Intronic
1048207928 8:132430546-132430568 AGTCGGGAAGGCCCCGCTGATGG - Intronic
1053619314 9:39799367-39799389 AACTGGGAAGGACCCACTGCAGG - Intergenic
1058984050 9:110195505-110195527 GGCCAGGATGGCGCCACTGAGGG + Intronic
1059029746 9:110678354-110678376 AGCCCAGAAGGATCCACTGAAGG - Intronic
1060778977 9:126397965-126397987 AGCCCTGCAGGCCCCACTGAGGG - Intronic
1061722815 9:132563516-132563538 ATCCGAGCAGGCCCCACTGATGG + Intronic
1061968986 9:134033666-134033688 AGCCTGGACGGGCCCCCTGAGGG + Exonic
1203791116 EBV:152100-152122 TGCAGGGAAGGCCCCACCAAAGG - Intergenic
1203472082 Un_GL000220v1:119633-119655 AGCCGAGAAGGCACCAAGGAAGG - Intergenic
1203472180 Un_GL000220v1:120178-120200 AGCCGAGAAGGCACCAAGGAGGG - Intergenic
1185467574 X:363728-363750 AGACGGGAAGGCGCCGCTGCGGG - Intronic
1193493194 X:82175929-82175951 AACTGGGAAGGTCCTACTGATGG - Intergenic
1199654883 X:149984458-149984480 AAGCAGGAAAGCCCCACTGAAGG - Intergenic
1200045117 X:153396995-153397017 AGCCAGGAAACCCCCACTGGAGG - Intergenic
1201764157 Y:17563817-17563839 TGCCGGGAAGGCACGACTGCCGG + Intergenic
1201837396 Y:18342173-18342195 TGCCGGGAAGGCACGACTGCCGG - Intergenic