ID: 1149017107

View in Genome Browser
Species Human (GRCh38)
Location 17:51920726-51920748
Sequence GTGCAGAAGCATTCTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149017107 Original CRISPR GTGCAGAAGCATTCTGTTGT GGG (reversed) Intronic
900393165 1:2442649-2442671 GTGCAGAAGCAGCATGGTGTGGG + Intronic
901195607 1:7438297-7438319 GTGGAGAAGGACTCTGTTCTAGG + Intronic
902585251 1:17435112-17435134 GTGCGGAAGAAGTCTGGTGTTGG + Intronic
908286401 1:62608316-62608338 GAGCAGAAGGTTTGTGTTGTGGG - Intronic
910792701 1:91067585-91067607 GTGCAGAAGTAATGGGTTGTTGG - Intergenic
911686712 1:100785884-100785906 GGCCAGAACCATTCTGTGGTTGG + Intergenic
912647171 1:111404308-111404330 TGGCAGAAGCATGATGTTGTAGG - Intergenic
914398389 1:147292331-147292353 ATGCAAAAGGATTCTGATGTGGG - Intronic
916499224 1:165372606-165372628 GTGCAGAGGTATTCAGTTCTGGG + Intergenic
916744138 1:167671275-167671297 GTGCAGAAGCCTTCTATTTGTGG - Intronic
916899345 1:169203615-169203637 GGCCAGAACCATTCTGTGGTTGG + Intronic
917600944 1:176573071-176573093 GTGCTGAGGCATCCTGTTGTGGG + Intronic
920594140 1:207251464-207251486 GTTCAGAACCATTCTGTGTTTGG - Intergenic
920870227 1:209787968-209787990 ATGCAGAAGGATTCTGTTCCAGG + Exonic
921088674 1:211821374-211821396 GTGCAGAGTCATTCTTTGGTTGG - Intronic
922376086 1:224968562-224968584 GTACAGAAGCAGTGTGTTGAGGG + Intronic
1063254142 10:4308009-4308031 TTCCAAATGCATTCTGTTGTTGG + Intergenic
1064957597 10:20928559-20928581 AAGCAGAAGCAATCCGTTGTGGG + Intronic
1067489772 10:46687612-46687634 TTGGAGCAACATTCTGTTGTGGG - Intergenic
1067604896 10:47652772-47652794 TTGGAGCAACATTCTGTTGTGGG + Intergenic
1067829996 10:49606120-49606142 GTGGAGAAGCAGGCTGGTGTTGG - Intergenic
1069134983 10:64752605-64752627 GAGAAGAAGAATTCTGTTGAGGG + Intergenic
1069615769 10:69805266-69805288 CTGCAGCAGCCTTCTGTTTTTGG - Intronic
1070363921 10:75717406-75717428 GTGCTCAAGCCTTCTGTTGCAGG - Intronic
1072484288 10:95840037-95840059 ATGCAGAAGTGTTCTGTTGATGG - Intronic
1079951431 11:26809890-26809912 GTGTAAAAGCATTCTTTTTTCGG + Intergenic
1081489614 11:43557255-43557277 GTGGAGAAGTATTCTGTAGTGGG + Intronic
1081800762 11:45857673-45857695 GTGCAGAAGAATTATATTGAAGG + Intronic
1087237879 11:95740389-95740411 TTGCATATGCAGTCTGTTGTTGG - Intergenic
1087389545 11:97515928-97515950 GGGCAGAAGCATTTCCTTGTCGG - Intergenic
1089055861 11:115584329-115584351 GAGAAGAAGAATTCTGTTGAGGG + Intergenic
1092054786 12:5499882-5499904 GTTCAGGAGCATTCTTTTGCAGG - Intronic
1092861204 12:12720645-12720667 GGGCCGAATAATTCTGTTGTAGG + Intronic
1093657604 12:21714710-21714732 GTGCAGAAACATTTTGTGTTTGG + Intronic
1098092233 12:66915990-66916012 GGGCTGAAGCATGCTTTTGTTGG + Intergenic
1099706706 12:86163127-86163149 GTGCAGAAGCTTTCTGGTAAAGG - Intronic
1100344349 12:93712590-93712612 ATCCAGAAGCATTCTGTTCCAGG + Intronic
1111360623 13:87170661-87170683 GTGCAGAAGCATTATAGTTTGGG + Intergenic
1112766576 13:102752102-102752124 GGGCAGAACCACTCTGTGGTTGG - Intronic
1113286994 13:108860621-108860643 GTGCAGCAGTACACTGTTGTTGG - Intronic
1116269743 14:42746663-42746685 TTGTAGAAGCCTTCTGTTTTTGG - Intergenic
1117597449 14:57338042-57338064 GTGCAGAAGCTTTTTTTTGGGGG + Intergenic
1125250215 15:37693045-37693067 GTGCAGAAGGATTTTGGTTTTGG - Intergenic
1126928324 15:53617012-53617034 GTATAGAAGCATTGTTTTGTAGG - Intronic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1129354062 15:74976048-74976070 GTGCACAGGCATCGTGTTGTTGG - Intronic
1129622698 15:77163437-77163459 CTGCAGAAGCAATCTCCTGTGGG + Intronic
1129748803 15:78045036-78045058 CTGCAGAAGCATTTGGGTGTGGG + Exonic
1132282749 15:100634414-100634436 GTGCTTAAGCATTCTGAGGTGGG - Intronic
1133388425 16:5389352-5389374 GGGCTGGATCATTCTGTTGTGGG + Intergenic
1134103980 16:11472107-11472129 GTGCAGAAATATTTGGTTGTTGG - Intronic
1136653985 16:31698526-31698548 TTTCAGAAGCATTCTCTGGTGGG + Intergenic
1136672539 16:31871979-31872001 TTTCAGAAGCATTCTCTGGTGGG + Intergenic
1138861218 16:60759905-60759927 GATCTGAAGCATTCTGTTTTAGG - Intergenic
1139280921 16:65769810-65769832 GGCCAGAACCACTCTGTTGTTGG + Intergenic
1139496444 16:67322995-67323017 GTGAAGTAGTATTCTGTTGTGGG - Intronic
1141729490 16:85812211-85812233 GTGCAGAAGCAGGCGATTGTGGG + Intergenic
1141930401 16:87198408-87198430 GGGCAGAAGCATCCTGTGGCTGG + Intronic
1143572972 17:7772197-7772219 GTGCAGAAGAATTCTGGTGGGGG + Intronic
1145259276 17:21345151-21345173 GTGCAGAAAGATTCTGGTGCTGG + Intergenic
1145317339 17:21742798-21742820 GTGCAGAAAGATTCTGGTGCTGG - Intergenic
1146697417 17:34920209-34920231 GTGCAGATGCAAGCTGTTGGTGG - Intergenic
1146862895 17:36320525-36320547 CTGCGGCAGCATTCTTTTGTTGG - Intronic
1147020101 17:37524513-37524535 GTGCAAAAGGACTCTGGTGTAGG + Intronic
1147093224 17:38124608-38124630 CTGCGGCAGCATTCTTTTGTTGG - Intergenic
1147103983 17:38195880-38195902 CTGCGGCAGCATTCTTTTGTTGG + Intergenic
1149017107 17:51920726-51920748 GTGCAGAAGCATTCTGTTGTGGG - Intronic
1154966773 18:21366308-21366330 CTGCAGAAGCTTTCTGGTATGGG - Intronic
1155526422 18:26720682-26720704 AGGCAGAAGCATCCTGTTGAGGG + Intergenic
1156348936 18:36286205-36286227 GTGCTGAAGCTCTCTGTTGCAGG + Intergenic
1158698089 18:59720371-59720393 TTGCAGTAGCTTTATGTTGTGGG - Intergenic
1158752291 18:60276294-60276316 TTACAGAAGCATTCTTTTCTAGG + Intergenic
1159157908 18:64608149-64608171 GGGCAGAAGCATTGTCATGTTGG + Intergenic
1159569042 18:70091066-70091088 CTGCAGAAGAATTCTGTTTCAGG + Intronic
1161909857 19:7185299-7185321 GTGCAGCAGCATGCTGGAGTTGG - Intronic
1163227493 19:15974671-15974693 CTGCAGAAGCCTTTTGTTGTAGG + Intergenic
1166341237 19:42138534-42138556 GCGCAGAAGCATTCTGTGTAAGG + Intronic
1168311779 19:55464396-55464418 GTGCAGAAACCTTCTGTGGTTGG + Intergenic
925428096 2:3767886-3767908 GTGCAGTTTCATTCTGCTGTAGG + Intronic
930118752 2:47742523-47742545 GAGAAGAAGAATTCTGTTGAGGG - Intronic
936138746 2:109920097-109920119 CTGCAGAAGTATTATGTTATGGG + Intergenic
936205950 2:110451388-110451410 CTGCAGAAGTATTATGTTATGGG - Intronic
938715844 2:134021102-134021124 GTGCAGAAGCATACTCCGGTGGG + Intergenic
939545886 2:143552202-143552224 GTTCAGATGCATTTTGTTATGGG + Intronic
939636037 2:144583570-144583592 AAGCAGAAGCATTTTGGTGTGGG - Intergenic
943523537 2:188986850-188986872 CTACAGAAGCATTTTCTTGTGGG - Intronic
943575246 2:189624469-189624491 GTACAGAAACATTTTGTTGATGG - Intergenic
943622210 2:190161692-190161714 GAGTAGAAGTATTCTCTTGTTGG + Intronic
944656003 2:201877299-201877321 GTTCAGGAGCCATCTGTTGTGGG + Intronic
945293501 2:208147833-208147855 CTGCAGCAGCATTCTATTTTGGG + Intergenic
945418512 2:209604849-209604871 CTGCAGAAGTATTCTGTTTTGGG - Intronic
946397422 2:219449922-219449944 GTGCAGAGCCATTCTCCTGTTGG - Intronic
946593544 2:221278911-221278933 CTTCAGAAACATTCTGTTGCTGG - Intergenic
1170988322 20:21278989-21279011 GTGCAGAACAGTTCTTTTGTAGG - Intergenic
1172867680 20:38112638-38112660 GGGCAGGAGCATTCTGTTGTGGG + Intronic
1175489607 20:59371007-59371029 GTGCAGAAGCATGTTGCTGGAGG + Intergenic
1177109099 21:17002476-17002498 GTGCAGAAATATTCTTTTCTAGG - Intergenic
1177194226 21:17885690-17885712 GTGCAGGAGTCTTCTGGTGTGGG + Intergenic
1178213675 21:30568808-30568830 GAGCAGAAGCAGTCTGTGGTTGG - Intergenic
1178709656 21:34904777-34904799 TTTCAGAAGTATTCTGTTTTAGG + Intronic
1183217574 22:36490789-36490811 ATGCACCAGCTTTCTGTTGTGGG - Intronic
1183911878 22:41085961-41085983 TTGCAGATGCATGCTGGTGTTGG - Intergenic
949963293 3:9332798-9332820 TTGAAGAAGCATTTAGTTGTAGG - Intronic
951183051 3:19681748-19681770 GTGAAGAGGCATTCTGGTTTTGG + Intergenic
957255541 3:77831701-77831723 GTGCAAATGCTTTCTGTTGCTGG - Intergenic
964110568 3:153083173-153083195 GAGAAGAAGAATTCTGTTGGGGG - Intergenic
967273113 3:187746982-187747004 GTGCAGAATCATTTCATTGTGGG + Intergenic
967751304 3:193119269-193119291 GTGGAGAAGAATTCTATTGTGGG - Intergenic
968529318 4:1082295-1082317 GTGCAGCAGCCTTCTGTGGCCGG - Intronic
971883364 4:32410439-32410461 GAGAAGAAGCATTCTGGTTTTGG - Intergenic
972871870 4:43310376-43310398 GTGAAGGAGCAGTCTGTTGTCGG - Intergenic
973043131 4:45498635-45498657 GTGCATAGCCATTCTGTTGTGGG - Intergenic
975357797 4:73428515-73428537 GTGCAGAAGCATCCTAATTTTGG - Intergenic
980998212 4:139801972-139801994 GTGCAGCCGCATTCTGAAGTGGG - Intronic
983052008 4:163059502-163059524 GTACAGAAGCTGACTGTTGTGGG - Intergenic
984919159 4:184748810-184748832 GTGCAGAGGGATTCTGTTCTTGG - Intergenic
989223765 5:39001268-39001290 GTTCAGTAGCAATCTATTGTTGG - Intronic
989538451 5:42591020-42591042 GTACAGAAGCATTCTGCATTAGG + Intronic
990293381 5:54377825-54377847 GTGTATAAGCATTCCTTTGTTGG + Intergenic
990562872 5:57001009-57001031 GAGAAGAAGAATTCTGTTGAAGG + Intergenic
991591286 5:68254211-68254233 ATGCAGAATCATTCTTTTCTTGG - Intronic
995229372 5:109741217-109741239 GTGCAGATGAATTCTGTTTCTGG + Intronic
999790681 5:154937236-154937258 TGGCAGAATCATACTGTTGTTGG + Intronic
1003427620 6:6008096-6008118 CTGCAGAAGTATTTTGTTGCAGG - Intergenic
1004332359 6:14733460-14733482 GAGCAGAAGCAATCTTTTATCGG + Intergenic
1012053088 6:94368677-94368699 ATGCAGAAGCTTTCTTTTTTAGG + Intergenic
1013311871 6:108902037-108902059 ATGCTGATGCATTCTGTTGCTGG + Intronic
1013364843 6:109429265-109429287 GTGCAGAAGCAGGCTGGAGTAGG - Intronic
1015736177 6:136402457-136402479 GTGCAGGAGCACCGTGTTGTGGG - Intronic
1027240569 7:76325290-76325312 GTGCAAAAGCAGCCTGGTGTGGG + Intergenic
1028080429 7:86568250-86568272 GAGAAGAGGCATTCTGTTTTTGG - Intergenic
1030299263 7:107959163-107959185 GTGGAGATGAATTCTGTGGTTGG + Intronic
1030313507 7:108091513-108091535 GGGCAAAAGCATTCTTTTCTAGG + Intronic
1031084748 7:117291404-117291426 GTGCAGACGCATTCTCTGGAGGG + Intronic
1031926449 7:127643127-127643149 GTGCAGACACATTCTATTGTTGG + Intergenic
1032081106 7:128858854-128858876 GTGGGGGAGCATTGTGTTGTGGG + Exonic
1032757246 7:134902680-134902702 TTTCAGATGCCTTCTGTTGTAGG - Intronic
1033818586 7:145106222-145106244 CTCCAGAAGCATTCTCTTTTGGG - Intergenic
1035276456 7:157750876-157750898 GTGCAGCTGCATTCTGGGGTGGG + Intronic
1039087418 8:33793722-33793744 CTGGTGCAGCATTCTGTTGTGGG + Intergenic
1039301094 8:36209554-36209576 GTGAAGAGGAATTCTGTTGAAGG - Intergenic
1043335926 8:79177026-79177048 TTTCAGAAGCATTGTATTGTAGG - Intergenic
1043773678 8:84237223-84237245 GTGCAGCAGGATTCTCTTGGTGG + Intronic
1043773799 8:84239045-84239067 GTGCAGCAGCTTTCTGTTATAGG + Intronic
1043984725 8:86680571-86680593 GTGCAGAAGCATTTTCCTCTAGG + Intronic
1045659340 8:104420554-104420576 GTGCAAAAACATTCTGATGATGG + Intronic
1046423775 8:114019051-114019073 ATGCACAAGAATTCTGTGGTTGG - Intergenic
1046568345 8:115930341-115930363 CTGCAGAAGCACTGTGTTGGAGG - Intergenic
1047335089 8:123928436-123928458 GAGTAGAACCATTCTGCTGTGGG + Intronic
1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG + Intergenic
1057864421 9:98667717-98667739 GTGCAGGAGCTTTATGTTGCAGG - Intronic
1058511344 9:105721740-105721762 GTTCATAAATATTCTGTTGTTGG + Intronic
1061354298 9:130092525-130092547 GTGCGGGAGCATTATGGTGTGGG + Intronic
1061473157 9:130843628-130843650 AAGGAGAAGCATCCTGTTGTGGG + Intronic
1186295093 X:8140710-8140732 GAGAAGAAGAATTCTATTGTGGG + Intergenic
1189599512 X:42607840-42607862 GTGCACAAGCACTATGATGTAGG - Intergenic
1190897549 X:54635790-54635812 TTGCAGAATCATTTTGTTCTAGG + Intergenic
1195177350 X:102323593-102323615 GTTAAGAAGGATCCTGTTGTTGG + Intronic
1195181514 X:102363500-102363522 GTTAAGAAGGATCCTGTTGTTGG - Intronic
1196088983 X:111718644-111718666 GTGCCTAAGCATTCTGATGTAGG + Intronic
1197043515 X:121969374-121969396 GTGTAGAAGTATTGTGTTCTTGG + Intergenic