ID: 1149017640

View in Genome Browser
Species Human (GRCh38)
Location 17:51926726-51926748
Sequence AAGGACTCTATGGTTACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149017632_1149017640 28 Left 1149017632 17:51926675-51926697 CCTCACGTCTCTGTTCTGATTCG 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1149017640 17:51926726-51926748 AAGGACTCTATGGTTACAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1149017634_1149017640 -1 Left 1149017634 17:51926704-51926726 CCTGCTTCTGTCTTTTCCTTTTA 0: 1
1: 0
2: 7
3: 114
4: 1230
Right 1149017640 17:51926726-51926748 AAGGACTCTATGGTTACAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149017640 Original CRISPR AAGGACTCTATGGTTACAAG GGG Intronic
905107281 1:35571789-35571811 ATGGAATATATGGTTCCAAGTGG - Intergenic
916443524 1:164850912-164850934 AAGGCCTCTTTGGTTGGAAGAGG - Exonic
1064688521 10:17889772-17889794 AAGGACTCTAATGTAAAAAGTGG - Intronic
1068639446 10:59386755-59386777 CAGGACTGTATGTTTACATGTGG - Intergenic
1069177611 10:65312884-65312906 AAGGACTGTATGGTGGCAGGGGG - Intergenic
1071419341 10:85475628-85475650 AAGTACTCTCTCTTTACAAGTGG - Intergenic
1086884671 11:92191413-92191435 AAGGAAACCAAGGTTACAAGAGG + Intergenic
1089373122 11:117975632-117975654 AAGGATTCTAGGGTTCCATGGGG + Intergenic
1090931606 11:131302524-131302546 AAGGGCTGTATGGTTACGAATGG + Intergenic
1091593690 12:1860595-1860617 CATGACTCTATGGTTCCTAGAGG + Intronic
1091972393 12:4798218-4798240 AAGGACTTTATGGTTAAGAATGG - Intronic
1092602050 12:10077908-10077930 AAGAATTCTCTGGCTACAAGGGG - Intronic
1093946921 12:25119996-25120018 GAGGACTCTTTGGGTTCAAGGGG + Intronic
1104529102 12:129551979-129552001 AAGGACTTTCTGGTCAGAAGAGG - Intronic
1105413628 13:20191926-20191948 AGGGACTCTAAGGTCACATGGGG + Intronic
1106139866 13:27003164-27003186 AAGGACTCTGTGATTACATTGGG - Intergenic
1110360259 13:74616649-74616671 AAGGACTCTAATGGAACAAGTGG + Intergenic
1117367600 14:55045340-55045362 AGGTACTCTTTGGTTACCAGTGG - Exonic
1120435390 14:84475320-84475342 CATGACTCTCTGGTTACCAGGGG + Intergenic
1121593129 14:95135628-95135650 AAAGACTATATGGATACAAATGG + Intronic
1123477816 15:20603351-20603373 CAGAGCTCTATGGTTAAAAGTGG + Intergenic
1123640199 15:22397032-22397054 CAGAGCTCTATGGTTAAAAGTGG - Intergenic
1124420381 15:29515908-29515930 AAGGGCTTAATGGTCACAAGTGG - Intronic
1127198552 15:56617367-56617389 AAGGAGTATATGGTCTCAAGTGG + Intergenic
1132265135 15:100463521-100463543 TAGGATTCTATGGTTTGAAGAGG + Intronic
1137063266 16:35811321-35811343 AAGGACTCTAAAGTAACATGGGG + Intergenic
1137954022 16:52810601-52810623 AGGGACTCTATGTTTTCAACTGG + Intergenic
1139103603 16:63799974-63799996 CAGGACTATGTGGTTGCAAGTGG + Intergenic
1141138488 16:81482193-81482215 AAGGACCCTGTGGTTACACTGGG + Intronic
1144843881 17:18205803-18205825 CAGGACTCTAAGGATACTAGAGG - Intronic
1148637098 17:49157130-49157152 AAGAACTCCATGGTGACAGGTGG - Intronic
1149017640 17:51926726-51926748 AAGGACTCTATGGTTACAAGGGG + Intronic
1155641022 18:28015214-28015236 AAGGATTTTATGGTTACTAAGGG - Intronic
1156799620 18:41094144-41094166 TAGGAATCTATGGATACAAAGGG - Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157352267 18:46899323-46899345 AAGCACTCTATGGATACCTGAGG + Intronic
1157520415 18:48341669-48341691 TAGGCCTCTAAGGTAACAAGCGG - Intronic
1161823165 19:6543841-6543863 AAAGACTGTTTGTTTACAAGAGG + Intergenic
926422435 2:12713491-12713513 AAGGATTATATAATTACAAGGGG - Intergenic
926888414 2:17618445-17618467 AAGGACTCTGTGATTACACTGGG + Intronic
928672276 2:33613784-33613806 AAGAACTCTGTGGTTAAAATTGG + Intergenic
932459234 2:71871817-71871839 AATGGGTCTCTGGTTACAAGGGG - Intergenic
936897935 2:117449781-117449803 AAGGACTCTCTGGCTCCAATTGG - Intergenic
937227846 2:120379802-120379824 GAAGCCACTATGGTTACAAGTGG + Intergenic
937493402 2:122393332-122393354 AAGCCATCTATGGTAACAAGGGG - Intergenic
941622369 2:167792731-167792753 AAGGATATTATGGTTACAATTGG + Intergenic
948141547 2:235676290-235676312 AAGGACTCACTAGTTAGAAGTGG - Intronic
1168827742 20:825176-825198 AAGCACTCTGTGCTTTCAAGGGG + Intergenic
1169267043 20:4172960-4172982 AAGGACGCTGCGGTTCCAAGTGG + Intronic
1170227433 20:14007310-14007332 AAGGACTCTTTGGTCACCTGTGG - Intronic
1170359089 20:15524837-15524859 AAGGACTCAATAGTCACATGTGG + Intronic
1170562927 20:17572473-17572495 AAAGATACTCTGGTTACAAGAGG - Intronic
1172842352 20:37909577-37909599 AAGGAATCTATGTTTATAGGGGG + Intronic
1178134378 21:29610382-29610404 AAGGACCCTGTGGTTACATTAGG - Intronic
1182258070 22:29052311-29052333 AAGGCCACTCTGGTTCCAAGTGG - Intronic
1182639135 22:31753029-31753051 AAGGTCTCTCTGGCTTCAAGAGG + Intergenic
1183149079 22:36023350-36023372 TATGACTCTATGGTGAGAAGCGG + Intronic
950173665 3:10856619-10856641 GAGGACTCTGTGGGTACCAGGGG - Intronic
954299572 3:49692641-49692663 AAGTACTGGATGGTTACCAGAGG - Intronic
959858413 3:111189009-111189031 AAGGACTATGTTGTTACCAGAGG + Intronic
964535382 3:157715826-157715848 AAGGACTCTGTGATTACATTGGG - Intergenic
965843426 3:172933783-172933805 AAGGAATCTTTGGTTTCAAGTGG - Intronic
971403635 4:26300128-26300150 AAGGACACTCTGGTCAGAAGTGG - Intronic
971759553 4:30747628-30747650 AAGGACACTGTGGTTACATTGGG + Intronic
972708533 4:41570372-41570394 AGGGACTCTCTGGTTTCAACAGG + Intronic
976982974 4:91255293-91255315 ATACACTCTATGGTTATAAGAGG - Intronic
978234384 4:106440716-106440738 AAGTCCTCTATGATAACAAGTGG + Intergenic
979027102 4:115591471-115591493 AAGGATATTATTGTTACAAGAGG - Intergenic
980528713 4:134022530-134022552 AAGGACTCTATTGATAAAAGAGG - Intergenic
980756299 4:137166940-137166962 AAGGACACTATTGGTACAATTGG + Intergenic
982150889 4:152455846-152455868 AAGGACTCTCTGATTACACTGGG + Intronic
984411410 4:179403427-179403449 CAGGACTCTATTGTTTCAAGAGG - Intergenic
986221393 5:5771866-5771888 AAGGACCCTTGGGTTACATGTGG + Intergenic
986649902 5:9953038-9953060 AAGGACCCTGTGATTACACGGGG + Intergenic
988983983 5:36599104-36599126 AAGTGCTCAATGGTTACATGTGG + Intergenic
991695746 5:69269474-69269496 AAGGACTACATGTATACAAGAGG - Intronic
995015535 5:107304953-107304975 AAGGACCCTGTGGTTACATTGGG + Intergenic
1005807748 6:29490823-29490845 AAGGATTCCATGGTTGAAAGAGG - Intergenic
1005844898 6:29769567-29769589 GAGGACACCAGGGTTACAAGAGG + Intergenic
1010987312 6:82439698-82439720 GAGGATTATTTGGTTACAAGAGG + Intergenic
1011761286 6:90568354-90568376 AAGGACTATATGAGTACATGTGG - Intronic
1012258666 6:97062552-97062574 AAGGACTCTATATTTCTAAGTGG - Intronic
1017977774 6:159373347-159373369 AAGGATTCTATGATTCCAACTGG + Intergenic
1020475394 7:8588329-8588351 AATGACACTATGGATGCAAGTGG + Intronic
1021714798 7:23451952-23451974 AAGGAATATATGGTTAGAATAGG + Intronic
1022888784 7:34674788-34674810 AGGGACTCTATGGCAACATGTGG - Intronic
1027550005 7:79579222-79579244 AAGGACTCTCTGATTACATTGGG - Intergenic
1030104507 7:105975690-105975712 AAGGCCTCTGCGGTTACCAGTGG - Intronic
1030240160 7:107313730-107313752 AAGGACTATATGATTACACTGGG + Intronic
1031316420 7:120262949-120262971 AAGGACTGTATAGTCAAAAGGGG - Intergenic
1035653181 8:1284187-1284209 AAGGGCTCTGTGGTTGCCAGTGG + Intergenic
1036200339 8:6765536-6765558 AAGGACTCTATAGCCACATGGGG - Intergenic
1037025905 8:14037591-14037613 AAGGATTTTATGATTACAAACGG + Intergenic
1045245138 8:100435995-100436017 AAGGACTCTTTGGTTACATTGGG + Intergenic
1050706075 9:8399363-8399385 AAGTGCTCTATGTTTTCAAGTGG + Intronic
1051704019 9:19857295-19857317 AAGGACCCTGTGGTTACAGTGGG + Intergenic
1051919145 9:22243790-22243812 AAGGACTCAGTGGTTACTTGAGG - Intergenic
1052623910 9:30949924-30949946 AAGTACTCAATGGCCACAAGTGG - Intergenic
1057472453 9:95369587-95369609 AAGGACTCTGTGGTTACATTTGG + Intergenic
1058060687 9:100492689-100492711 GAAGACTGTTTGGTTACAAGGGG + Intronic
1058715884 9:107721662-107721684 AGGCTCTCTATGGTTATAAGTGG - Intergenic
1187280606 X:17855958-17855980 AAGCACTCTATGGCTGCATGTGG + Intronic
1189184423 X:39040963-39040985 AAGGACTCTGTGGCTAGAGGAGG + Intergenic
1193313164 X:80031881-80031903 AAAGACATTATGATTACAAGAGG + Intergenic
1199539507 X:148943673-148943695 TGTGACTCTATGGTTCCAAGAGG - Intronic
1201424775 Y:13835903-13835925 AAGGACTCTATCTTTAACAGGGG - Intergenic