ID: 1149018796

View in Genome Browser
Species Human (GRCh38)
Location 17:51939210-51939232
Sequence TCTATTAGTATGGACATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149018796 Original CRISPR TCTATTAGTATGGACATGGA GGG (reversed) Intronic
900073001 1:788970-788992 TCTAATGGAATGGACATGAATGG + Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
907787872 1:57631172-57631194 TTTATTGGGATGGTCATGGAAGG + Intronic
908501472 1:64746799-64746821 TCTATTTGTATGGGCAGGGGAGG - Intronic
910676120 1:89818720-89818742 TCTATTTGTACCTACATGGAAGG - Intronic
914226822 1:145727258-145727280 TCTATAAATATGGGCCTGGAGGG - Intronic
920613657 1:207467780-207467802 CATATATGTATGGACATGGAAGG + Intronic
920640585 1:207748202-207748224 TCTATTAATATGCAAATGCAGGG - Intergenic
921332032 1:214049154-214049176 GCCCTTTGTATGGACATGGATGG + Intergenic
921491448 1:215781157-215781179 AGTATAAATATGGACATGGAAGG - Intronic
922268594 1:224011953-224011975 TCTAATGGAATGGACATGAATGG + Intergenic
923749444 1:236734074-236734096 TCTATTACTACACACATGGAGGG - Intronic
1064740051 10:18423744-18423766 TCCAATAGTCTGCACATGGAGGG - Intronic
1070500745 10:77070540-77070562 CCTATTAGGATGGACAAAGAAGG - Intronic
1071178926 10:82960440-82960462 TCTATTTGTACGGAAATGGCTGG + Intronic
1072976549 10:100063693-100063715 TCTACTCCTATGCACATGGATGG - Exonic
1073748374 10:106495610-106495632 TCTTGTAGTATGGCCAAGGAGGG - Intergenic
1076363189 10:129904383-129904405 GCTATGAATATGGAGATGGATGG + Intronic
1079892966 11:26080694-26080716 TGTATAAATATGGAAATGGAAGG - Intergenic
1079931974 11:26574675-26574697 TCTATTAGGATAGAAATAGAGGG + Intronic
1080265225 11:30393218-30393240 TCTATTAGGAAGGACACAGAGGG - Intronic
1082690629 11:56299337-56299359 TCTATGATTGTTGACATGGATGG - Intergenic
1082696148 11:56367273-56367295 TTTATTCGTATGGAAAAGGAGGG - Intergenic
1088402915 11:109440972-109440994 TCTATTAGTAAATCCATGGAAGG + Intergenic
1089289875 11:117431126-117431148 TCTGTAAGTCTGGCCATGGAGGG + Intronic
1093981629 12:25481177-25481199 TCAAATAGGATGGACAAGGAAGG - Intronic
1097419655 12:59358917-59358939 TCTATTAATTAGGGCATGGAGGG + Intergenic
1097570912 12:61330439-61330461 TCTATAAGTATGGAAAGGAATGG + Intergenic
1099349802 12:81551393-81551415 TTTATCTGTTTGGACATGGAAGG - Intronic
1100605216 12:96146712-96146734 CCTATTAATATGGACTTGGAAGG + Intergenic
1108101310 13:46959253-46959275 TCTAGGAGCATAGACATGGATGG + Intergenic
1108573145 13:51769586-51769608 TCTCTTAGGATGGAAAGGGAGGG - Intronic
1111642226 13:90982935-90982957 GCTATTTGCAGGGACATGGATGG + Intergenic
1112235423 13:97631460-97631482 TCAATCAGAATGGACATGGCAGG - Intergenic
1114251955 14:20969319-20969341 GCCATTAGCATGGACATGGAAGG - Intergenic
1114438008 14:22724062-22724084 TCTATTAGTACAGAAATGGGTGG - Intergenic
1114794732 14:25700650-25700672 TAAATTAGTATGGTCAGGGAAGG - Intergenic
1117014707 14:51506859-51506881 TCTATAATTATTAACATGGAAGG + Intronic
1121434509 14:93910285-93910307 TCTTTGACTCTGGACATGGAAGG + Intergenic
1128825014 15:70706393-70706415 TCTATTAGCATAGAACTGGAAGG + Intronic
1130896790 15:88176904-88176926 TCTATTTGTAAGGAGAAGGAAGG + Intronic
1133565608 16:6990540-6990562 TCTGTTAGTATTCACATAGAAGG + Intronic
1136669978 16:31847514-31847536 TTTATTAGGAAGGAAATGGAGGG + Intergenic
1145334254 17:21899012-21899034 TCAAATAGAATGGACATGAAAGG + Intergenic
1145697031 17:26796888-26796910 TCAAATAGAATGGACTTGGAAGG + Intergenic
1149018796 17:51939210-51939232 TCTATTAGTATGGACATGGAGGG - Intronic
1149219237 17:54396571-54396593 TGTTTTAGGATGGAAATGGAGGG + Intergenic
1203193645 17_KI270729v1_random:211996-212018 TCAAATAGAATGGACATGAAAGG + Intergenic
1203203009 17_KI270730v1_random:11426-11448 TCAAATAGAATGGACATGAAAGG + Intergenic
1158620355 18:59027546-59027568 TCTGTGAGTATGGACATCCAAGG + Intergenic
1168376900 19:55887514-55887536 TCTAATAGTGAGAACATGGATGG + Intergenic
927819221 2:26248012-26248034 GCTATGAGTCTAGACATGGAAGG - Intronic
927908293 2:26877832-26877854 TCTCTAAGTATTGACATGGGAGG - Intronic
933072044 2:77871144-77871166 TCCTTTTGTAGGGACATGGATGG - Intergenic
934865937 2:97811283-97811305 CCTATTAAAATGGACATGAAGGG + Intronic
935167410 2:100581480-100581502 TCTATTAGGATGGACTTGTGGGG + Intergenic
937295344 2:120806752-120806774 TCTCTTTGAATGGACATTGAGGG + Intronic
937601527 2:123742019-123742041 TCTATTAGAATGGTGAAGGAGGG + Intergenic
941904810 2:170710542-170710564 TCTGTTGGTGTGGACATGGTGGG - Intergenic
943847664 2:192672822-192672844 CCTATCAGAATGGCCATGGATGG - Intergenic
944635982 2:201676523-201676545 TCAATTAGCATGGACATGCAGGG + Intronic
946676905 2:222169976-222169998 TCTATTAGAATGGAAAAAGAAGG + Intergenic
1170427129 20:16246207-16246229 GCCATTGGTATGAACATGGAGGG + Intergenic
1170843630 20:19943916-19943938 TCTATTAGTCTGGAGAAGAAGGG - Intronic
1171931300 20:31231496-31231518 TCTGTTTGAATGGACATGAATGG + Intergenic
1176748986 21:10675936-10675958 TCGAATAGAATGGACATGAATGG - Intergenic
1177344838 21:19855072-19855094 TCTCTTAGTAGGACCATGGAGGG - Intergenic
1177683371 21:24404417-24404439 TTACTTAATATGGACATGGATGG + Intergenic
1178498302 21:33105233-33105255 TCCATTCTTATGGAAATGGAGGG - Intergenic
1179263392 21:39778661-39778683 TCAATGAGTGGGGACATGGAAGG + Intronic
954822290 3:53340744-53340766 TGTATTAGTATGGATATTGAAGG - Intronic
962154678 3:132933687-132933709 TCTGGTAGTCTGGATATGGAAGG - Intergenic
964238112 3:154558269-154558291 TCTTTTAGTATATACATAGAGGG + Intergenic
966638685 3:182164241-182164263 TCTATTTGTTTGCACATGAATGG - Intergenic
966987230 3:185192430-185192452 TCTATTTACATGGATATGGATGG - Exonic
969170854 4:5361956-5361978 TCAATTAGTATGAATATGAAAGG - Intronic
971258879 4:25038256-25038278 GATATGGGTATGGACATGGATGG + Intergenic
972386006 4:38566172-38566194 TGTTTTAGTATGGATATGGCTGG - Intergenic
972983387 4:44732980-44733002 TCTATTAGTCAGGAGAGGGAGGG + Intergenic
976805857 4:89046151-89046173 TCTGGTAGTTTGGACAAGGAAGG - Intronic
977083863 4:92569273-92569295 GTTATTTGCATGGACATGGATGG - Intronic
977183674 4:93909599-93909621 TCTGTTTGCAGGGACATGGATGG - Intergenic
977414561 4:96715732-96715754 AGTCTTAGTATGGAGATGGATGG + Intergenic
979124813 4:116956029-116956051 TCTATGAGTAGGGAGGTGGATGG + Intergenic
979926447 4:126571599-126571621 TCTGTTAATATGGATAAGGATGG - Intergenic
980925913 4:139137401-139137423 TATATTAGAATGAACTTGGAGGG - Intronic
981770904 4:148306635-148306657 TCTCTCAGTATGGACTAGGAAGG + Intronic
981990186 4:150909574-150909596 AATATTACTATGAACATGGATGG + Intronic
982467451 4:155748217-155748239 ACCATTGGTATGGAAATGGAGGG - Intergenic
985985119 5:3509087-3509109 TATGTTAGCATGCACATGGAGGG - Intergenic
987201546 5:15582751-15582773 TCTAGTAGTATGGAAATGAAGGG - Intronic
988075810 5:26352668-26352690 TATATTAGTATCAACATGAAGGG - Intergenic
992358337 5:76009048-76009070 TTTCTTAGAATGGACATGGTGGG - Intergenic
993420198 5:87692013-87692035 TCCCTTTTTATGGACATGGATGG - Intergenic
993620308 5:90160694-90160716 TCTATTAGTTTGGAAATCCAGGG - Intergenic
994615811 5:102102506-102102528 TCGGTTGGTATGGAAATGGAGGG + Intergenic
996020947 5:118589955-118589977 TCTATTAGCAAAGACATGGTGGG + Intergenic
999168654 5:149573839-149573861 TCTATGAGTATTGACATGTAAGG - Intronic
1001103091 5:168830127-168830149 TCTATTAGAATCTGCATGGATGG + Intronic
1003408784 6:5845193-5845215 TCTATTAACAAGGAAATGGAGGG + Intergenic
1005148760 6:22723221-22723243 TCAATTATTATGGAAAAGGAAGG + Intergenic
1013922508 6:115424876-115424898 TCTATTAGGAAGGATTTGGAGGG + Intergenic
1015187052 6:130429732-130429754 CCTATCAGTATGTTCATGGATGG - Intronic
1023743159 7:43299016-43299038 TCTATTAGTCTGGACATAGATGG + Intronic
1028354162 7:89886316-89886338 CTTATTTGTATGGACATGGATGG - Intergenic
1028487293 7:91373850-91373872 TCTATCAGTCAGAACATGGAAGG + Intergenic
1032086035 7:128884453-128884475 TCTATTTGCAAGGCCATGGAAGG - Intronic
1032171553 7:129588694-129588716 TCTATGATTCTGGACATTGAAGG - Intergenic
1039107603 8:34006024-34006046 TCTATTAATATGGCCTTTGAAGG - Intergenic
1041191655 8:55361377-55361399 TCTGTTAGTGTCCACATGGAGGG + Intronic
1042806195 8:72773365-72773387 TCTATTAGTATTGACATGACTGG - Intronic
1045130248 8:99143850-99143872 TCTATTACTATGAAAAAGGATGG - Intronic
1045913596 8:107439921-107439943 GGTATTAGTCTGGACATGGTGGG + Intronic
1047675422 8:127196635-127196657 TCTATTAGTAGAGACTGGGAAGG + Intergenic
1048756849 8:137748788-137748810 TCTGTTTCTATGGAGATGGATGG + Intergenic
1055429609 9:76230297-76230319 TTTGTTAGGGTGGACATGGAGGG + Intronic
1203390671 Un_KI270438v1:94502-94524 TCCATTAGAATGGACTTGAAAGG + Intergenic
1189241303 X:39526618-39526640 TCTTTTATTATGTAAATGGAAGG + Intergenic
1189609893 X:42721051-42721073 TGTCTTTGTAGGGACATGGATGG - Intergenic
1189944090 X:46159395-46159417 TGTATATGTATGGATATGGAAGG - Intergenic
1190344087 X:49321922-49321944 TCAATGAGGATGGGCATGGAGGG + Intergenic
1190345181 X:49331467-49331489 TCAATGAGGATGGGCATGGAGGG + Intergenic
1190346275 X:49341033-49341055 TCAATGAGGATGGGCATGGAGGG + Intergenic
1190347527 X:49532062-49532084 TCAATGAGGATGGGCATGGAGGG + Intergenic
1190348628 X:49541618-49541640 TCAATGAGGATGGGCATGGAGGG + Intergenic
1190349729 X:49551174-49551196 TCAATGAGGATGGGCATGGAGGG + Intergenic
1190350833 X:49560727-49560749 TCAATGAGGATGGGCATGGAGGG + Intronic
1190351934 X:49570285-49570307 TCAATGAGGATGGGCATGGAGGG + Intergenic
1190353035 X:49579834-49579856 TCAATGAGGATGGGCATGGAGGG + Intergenic
1190354136 X:49589381-49589403 TCAATGAGGATGGGCATGGAGGG + Intergenic
1190355238 X:49598905-49598927 TCAATGAGGATGGGCATGGAGGG + Intronic
1194758067 X:97761232-97761254 TCTATGTGTATTGTCATGGAAGG + Intergenic
1195998194 X:110752487-110752509 ACAGTCAGTATGGACATGGAGGG + Intronic
1198633821 X:138673391-138673413 TCTTTTAATATGGAAATGCAGGG + Intronic
1199282479 X:146018463-146018485 TCTCTCAGTATGGACATCCATGG + Intergenic
1201207187 Y:11643632-11643654 TCTAATGGTATGGAAATGAAAGG + Intergenic
1201211163 Y:11681905-11681927 TCTAATAGAATGGACACGGAAGG + Intergenic
1201643528 Y:16202963-16202985 TCTCTTAGTTTGGACAAGGTAGG - Intergenic
1201659287 Y:16382358-16382380 TCTCTTAGTTTGGACAAGGTAGG + Intergenic
1202060674 Y:20884658-20884680 CCTTTTAGTATGGAAATGCAGGG - Intergenic