ID: 1149019684

View in Genome Browser
Species Human (GRCh38)
Location 17:51948599-51948621
Sequence CAGAATAAGGAGAAGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 379}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149019684_1149019689 -8 Left 1149019684 17:51948599-51948621 CCCAGTCCCTTCTCCTTATTCTG 0: 1
1: 0
2: 1
3: 31
4: 379
Right 1149019689 17:51948614-51948636 TTATTCTGCCGTCCCTGAAGTGG 0: 1
1: 0
2: 1
3: 8
4: 74
1149019684_1149019690 -1 Left 1149019684 17:51948599-51948621 CCCAGTCCCTTCTCCTTATTCTG 0: 1
1: 0
2: 1
3: 31
4: 379
Right 1149019690 17:51948621-51948643 GCCGTCCCTGAAGTGGTAGTTGG 0: 1
1: 0
2: 0
3: 3
4: 73
1149019684_1149019695 25 Left 1149019684 17:51948599-51948621 CCCAGTCCCTTCTCCTTATTCTG 0: 1
1: 0
2: 1
3: 31
4: 379
Right 1149019695 17:51948647-51948669 CTTTTATTATGACTTTTTTGTGG 0: 1
1: 1
2: 2
3: 91
4: 1333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149019684 Original CRISPR CAGAATAAGGAGAAGGGACT GGG (reversed) Intronic
901484480 1:9549116-9549138 CAGCAGGATGAGAAGGGACTGGG + Intronic
902403267 1:16169540-16169562 CAGGATCAGGACAAGGGACTGGG - Intergenic
902615444 1:17621070-17621092 AAGGGAAAGGAGAAGGGACTGGG + Intronic
902711043 1:18239972-18239994 CAGAATAAGAACAATGGGCTGGG + Intronic
903085896 1:20858536-20858558 CAAAGAAGGGAGAAGGGACTAGG - Intronic
903258279 1:22117261-22117283 TAGAATAGGGAGAAGAGACTTGG - Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
904007953 1:27373667-27373689 GAGGATTAGGAGAAGGGCCTGGG - Intronic
904007974 1:27373739-27373761 GAGGATTAGGAGAAGGGCCTGGG - Intronic
905855346 1:41307837-41307859 CAGAGTCAGGAGGAGGGACCAGG - Intergenic
906105640 1:43290508-43290530 CAGAAGGAAGAGAAGGGACAAGG + Intergenic
906522984 1:46478126-46478148 CAGAGGAGGGAGAAGGGTCTGGG + Intergenic
907659745 1:56381055-56381077 TAGAAGAAGGAGAAAGGAATGGG + Intergenic
907990082 1:59572337-59572359 AAGAATAAGCAGAAGGAAATTGG + Intronic
908205500 1:61844086-61844108 CAGAATAAAGAGAACAGACTTGG + Intronic
908768015 1:67571548-67571570 CAGCTGAAGGAGAAGGGGCTGGG + Intergenic
910259345 1:85280692-85280714 CAGAATAAGGATCAGGGATTGGG + Intergenic
911313388 1:96325725-96325747 CAGAAAAAGGAGAATGGATGGGG - Intergenic
911385934 1:97175614-97175636 AAGAATAAGGGCAAGGGAGTGGG + Intronic
912075286 1:105866831-105866853 GAGAATAAGGAGAAAGGAATAGG + Intergenic
912187007 1:107289612-107289634 TAGAATAAGGAAAAGTGCCTGGG - Intronic
912712048 1:111957013-111957035 CAGAACGAGAAGAAGGGCCTGGG + Intronic
913425412 1:118723572-118723594 AAGAATAAGGAGATTGAACTGGG + Intergenic
914345417 1:146794581-146794603 GAGAAGAAGGAGAAGGACCTGGG + Intergenic
916267331 1:162903891-162903913 CAGAAGAAAGTGAAGGAACTGGG + Intergenic
916935644 1:169625385-169625407 CAGAAGAATGAGAAGAGAATAGG - Intronic
917505344 1:175622385-175622407 CAGAAAAAGAAGGAGGGACCAGG - Intronic
917505479 1:175623502-175623524 CAGAAAAAGAAGGAGGGACCAGG - Intronic
917849902 1:179052838-179052860 CAGGATAGGAAGAAGGGAGTTGG - Intronic
918085093 1:181238299-181238321 CAGAAGGTGGAGAAGGGACTTGG + Intergenic
918091143 1:181296227-181296249 CAGAATGAGGAGAGGGGCCCTGG - Intergenic
918234688 1:182569388-182569410 AAGAACAAGAAGATGGGACTGGG - Intergenic
918613480 1:186517847-186517869 CAGAATAATGTGAAAAGACTAGG - Intergenic
918702230 1:187619763-187619785 CAGAAGAAGGAGAAAGAACTTGG + Intergenic
919261043 1:195194430-195194452 CAGAATTAGGAGAAGAGAAGTGG - Intergenic
919311795 1:195918409-195918431 CAGAAAAAGAGGAAGGGTCTGGG - Intergenic
920431628 1:205922541-205922563 CAGAAAATGGAGAAGGGCCTTGG + Intronic
920871366 1:209797943-209797965 CAGAATCAGAGGAAGGGATTGGG - Intronic
920881660 1:209886561-209886583 AAGAAAAAAGAGAAGGGAATAGG + Intergenic
920993382 1:210962145-210962167 CTGAGTAAGGAGATGGAACTAGG - Intronic
920995805 1:210989921-210989943 CAGAAGAAATAGTAGGGACTAGG - Intronic
924175935 1:241391167-241391189 CAGAAAAGGGAGCTGGGACTGGG + Intergenic
924623813 1:245684496-245684518 CAGCATCAGGAGATGTGACTTGG + Intronic
924847700 1:247789743-247789765 CAGACAGAGGAGAAGGGACTGGG - Intergenic
924849648 1:247812994-247813016 CATTATAATAAGAAGGGACTTGG + Intergenic
1063053252 10:2475987-2476009 CAGAACAATGAGAAGGGCATGGG - Intergenic
1064135287 10:12745441-12745463 CAGAATGTGGTGAAGGGAATTGG + Intronic
1064534698 10:16346645-16346667 CATAGTAGGGAGAAGGGGCTGGG - Intergenic
1066718520 10:38312751-38312773 CAAAATAAGTAGAAGGGGGTCGG - Intergenic
1067485576 10:46646736-46646758 CAGAATAAGGACTAGGAGCTGGG - Intergenic
1067609183 10:47694916-47694938 CAGAATAAGGACTAGGAGCTGGG + Intergenic
1067713179 10:48666523-48666545 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1068867321 10:61908505-61908527 GAGATTAAGGAGAATGGCCTCGG + Intronic
1069055862 10:63844088-63844110 AAGGATAAGGAGAAGGAAATAGG - Intergenic
1069701915 10:70433040-70433062 CACAACAAGTGGAAGGGACTCGG + Exonic
1071624770 10:87156562-87156584 CAGAATAAGGACTAGGAGCTGGG + Intronic
1074112272 10:110431083-110431105 CAGAAGGAGGAGCAGGGGCTAGG - Intergenic
1075954589 10:126511522-126511544 GAGAATGGGGAAAAGGGACTGGG - Intronic
1077502963 11:2917455-2917477 GACAATAAGGAGGAAGGACTCGG + Intronic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079515089 11:21257919-21257941 CAGATTGAGGAAAAGAGACTAGG - Intronic
1079991854 11:27254370-27254392 TAGAACCAGGAGAAGCGACTTGG - Intergenic
1080820426 11:35800664-35800686 CAGAAAGAGGTGAAAGGACTTGG + Intronic
1081048182 11:38303178-38303200 AAAAATAGGGAGAAGAGACTGGG - Intergenic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1083666151 11:64275814-64275836 CAGAACAAGCAGAAGACACTGGG + Intronic
1084072023 11:66743094-66743116 CTGAAAAAGGACAAGAGACTGGG + Intergenic
1084957524 11:72699206-72699228 CAGAATAAGGACAAGCGCCAAGG - Intronic
1085127046 11:74008918-74008940 GAGAACAAGGAGAAGGGAGAGGG + Intronic
1087044522 11:93833736-93833758 AAGAATGAAGAGAAAGGACTGGG - Intronic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1088078654 11:105882643-105882665 CAGAATAAGGGGAACGCAGTGGG - Intronic
1088254840 11:107893703-107893725 AAGAATAATGAAAAGGGGCTGGG + Intronic
1089194366 11:116685098-116685120 TAGAATAAGGAGAAGACAGTTGG + Intergenic
1089480287 11:118799249-118799271 CAGAATAAGTAGGAGGCCCTTGG + Intergenic
1090809254 11:130222223-130222245 CAGAAGAAGGGGATGGGAGTAGG - Intergenic
1091166459 11:133480396-133480418 CAGAAAAAGCAGAAGGCAGTGGG - Intronic
1091383241 12:76535-76557 CAGAGAAAGGAAAAGGAACTGGG - Intronic
1092629912 12:10365986-10366008 AAGAATAAGGAGAATGGTCAAGG + Intergenic
1093662632 12:21774806-21774828 CAGTGGAAGGAGGAGGGACTGGG + Exonic
1094014584 12:25849250-25849272 CTGAATATGGAGAAGGCTCTTGG + Intergenic
1096280595 12:50249609-50249631 CAGATTAATGGGTAGGGACTAGG - Intronic
1096396299 12:51269412-51269434 GAGAAAAAGGGGAAGGGACTTGG - Intronic
1097068507 12:56338045-56338067 CAGAATGAGGCCATGGGACTAGG + Intronic
1098150484 12:67541385-67541407 CAGAATAAGCAGAAGGGTATTGG + Intergenic
1098592735 12:72232596-72232618 TAGAATCAGGAGAAGGGTCTAGG + Intronic
1098657982 12:73057209-73057231 AAGAATAAGAAGAATGGGCTTGG - Intergenic
1098811274 12:75096370-75096392 CAGAAGAAGGAGAATCTACTGGG - Intronic
1098859895 12:75696665-75696687 CAGAAAAATAAGTAGGGACTTGG - Intergenic
1099205448 12:79721385-79721407 CAGAAAAGGCAGAAGGGGCTAGG - Intergenic
1100179396 12:92068686-92068708 CAAGAAAAGGAGAAGGGACAGGG + Intronic
1101008889 12:100429936-100429958 CAGAAGAAAGAGAAGGGAAGAGG - Intergenic
1101213250 12:102555744-102555766 TTGAAGAAGGAGTAGGGACTAGG - Intergenic
1101372226 12:104139903-104139925 TAGAATTGGGAGAAGGGGCTGGG + Intergenic
1101648881 12:106656677-106656699 GAGAATGAGGAGAAGGGAGATGG - Intronic
1102954117 12:117048444-117048466 CAGGAAAAGGAGATGTGACTCGG + Intronic
1103013309 12:117474682-117474704 CAGAAGGAGAAGAAGGGCCTAGG - Intronic
1107415583 13:40197054-40197076 GAATATAAGGAGAAGGGACAGGG + Intergenic
1108276705 13:48818159-48818181 CAGCATAAGAAAAATGGACTTGG - Intergenic
1108734621 13:53269657-53269679 AAAAATAAGGAGACGGAACTAGG - Intergenic
1108877000 13:55059821-55059843 TAGAATTAGGAGAAGGGAAAAGG + Intergenic
1112939109 13:104839469-104839491 AAGAAGAAGGAGAGGGGTCTTGG - Intergenic
1113404016 13:110021548-110021570 CAGAGTTATGAGAAGGGAATGGG + Intergenic
1114715612 14:24820846-24820868 GAGAATAAGGAAAAGTCACTGGG - Intronic
1115917210 14:38329312-38329334 AAGAAGAAGGAGAAAGGATTTGG + Intergenic
1116201250 14:41799958-41799980 AAGAAAAAGGAAAAGGGACAGGG + Intronic
1116774076 14:49159593-49159615 CAGACTAAGGAGAAGAGAAGGGG + Intergenic
1117664192 14:58039265-58039287 AAGGATAAAGAGAAGGGAATAGG - Intronic
1119388879 14:74276703-74276725 CAGAATGAGGAGATGGCGCTGGG - Intergenic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1120730345 14:87994019-87994041 CATGATAAGGCGAAGGGGCTTGG - Intergenic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121773973 14:96578115-96578137 CAGAATGAGGAGCAGCGCCTGGG - Intergenic
1122680803 14:103461037-103461059 CAGAATAAGCAGCAAGGACAAGG - Intronic
1123552633 15:21397851-21397873 CAGAAAAAGCAGATGGCACTGGG - Intergenic
1123588879 15:21835239-21835261 CAGAAAAAGCAGATGGCACTGGG - Intergenic
1124338618 15:28875744-28875766 CAGAAGATGGGGCAGGGACTGGG - Intergenic
1124660686 15:31548558-31548580 CAGAACAGGCAGAAGAGACTTGG - Intronic
1125347379 15:38731992-38732014 CAGAATAGGTAGAAGGGAAGTGG - Intergenic
1125408995 15:39385010-39385032 CCTTATAAGAAGAAGGGACTAGG + Intergenic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127690778 15:61394838-61394860 TAGAATAAGGAGAGGAGACCTGG + Intergenic
1127988124 15:64090882-64090904 TAAAATAAGCAGAAGGGAGTGGG + Intronic
1128076601 15:64830522-64830544 CAGAATCAGGGTAAGGGATTTGG - Intergenic
1128095675 15:64952843-64952865 AAGAAGAAGGAGAAGAGACAAGG - Intronic
1129771741 15:78207210-78207232 GAGATAAAGGAGAAGGGACTGGG - Intronic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1131745434 15:95442415-95442437 CAGAAGAAGTAGAAGTGACACGG + Intergenic
1202960982 15_KI270727v1_random:125071-125093 CAGAAAAAGCAGATGGCACTGGG - Intergenic
1133191937 16:4140243-4140265 CAGAAAAATGAGAAGAGCCTGGG + Intergenic
1133699308 16:8294310-8294332 CACAAAAAGGAGAGGAGACTTGG - Intergenic
1135718745 16:24795918-24795940 CAAAAAAAGGAGAAGGGAAAGGG + Exonic
1135872182 16:26161272-26161294 TAGAAGAAGAAGAAGGGTCTTGG + Intergenic
1136004276 16:27317888-27317910 CTGGATACGCAGAAGGGACTCGG - Intronic
1137375389 16:47947684-47947706 CAAAATAGGTAGAAGGAACTGGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137727124 16:50664579-50664601 CATAAAACAGAGAAGGGACTTGG - Intergenic
1138044282 16:53704456-53704478 CAGAAGAAGGACAAGGAAATGGG - Intronic
1138044346 16:53705220-53705242 CAGAGTAAGGAGAAAGGAAAGGG - Intronic
1138133960 16:54505302-54505324 AATAAAAAGGAGAAGGGAGTGGG + Intergenic
1138245000 16:55460805-55460827 CTAACTAAGGAGAAGGGAGTCGG - Intronic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1140042374 16:71416617-71416639 CAGAAAAAAGAGAAAAGACTTGG - Intergenic
1140057947 16:71542239-71542261 AAAAATAAGGGGAAGGGGCTTGG + Intronic
1140376115 16:74446659-74446681 AGGAAGAAGGAGGAGGGACTTGG - Intergenic
1141606111 16:85154267-85154289 CAGACCAAGGGGAAGGGGCTTGG + Intergenic
1141852187 16:86653998-86654020 TAGAATTATGAGAAGGGACAAGG - Intergenic
1145274250 17:21420602-21420624 CAGAATGTGGAGCAGGGGCTTGG + Intergenic
1145900698 17:28488860-28488882 CAGAAGAAGGAGCAGGACCTGGG - Intronic
1147371157 17:39994054-39994076 CAGAAAAAGGAGGAGGGTCAAGG - Intronic
1148073336 17:44921377-44921399 AAGAGCAAGGGGAAGGGACTTGG - Intergenic
1148199310 17:45739611-45739633 CAGAATCAGGACAAGGGCCAAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148826920 17:50400631-50400653 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1148854130 17:50569477-50569499 CAGAATTAGGAATAGGGCCTTGG - Intronic
1149019684 17:51948599-51948621 CAGAATAAGGAGAAGGGACTGGG - Intronic
1149170112 17:53799529-53799551 CAAAATATGGAGAAGGGGCATGG - Intergenic
1151154219 17:72113547-72113569 CAGAGACAGGAGAAGGGAATAGG + Intergenic
1151623870 17:75264294-75264316 CAGAAGAAGGCGAAGGGAGGTGG - Intronic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1156127787 18:33928030-33928052 CAGATTGAGGAGAAAGGACAGGG + Intronic
1156299598 18:35824613-35824635 CATAATAAGTAGATGGGAATGGG + Intergenic
1156948146 18:42860309-42860331 GAGAAGAAGGAGATGGGAATGGG + Intronic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1157592238 18:48842898-48842920 CAGAAGCAGGGGCAGGGACTGGG + Intronic
1158436263 18:57437023-57437045 AAGAATCAAGAGAAGTGACTCGG - Intronic
1158443826 18:57501446-57501468 CAGAACAAGGAGTAGCTACTAGG + Intergenic
1158786001 18:60712473-60712495 TAGAATTAGGAGAAGGGAAAAGG + Intergenic
1159852297 18:73538950-73538972 CAAAATGAAGAGAAGTGACTGGG + Intergenic
1160736594 19:665430-665452 CAGGGGAAGGAGAGGGGACTTGG - Intergenic
1161384720 19:3984916-3984938 CAGCATCAGGAGAAGGTATTTGG + Intronic
1162205704 19:9054705-9054727 CAGAAGAGAGAGAAGGAACTGGG - Intergenic
1163717723 19:18881637-18881659 CAGAGCAAGGAACAGGGACTTGG - Intronic
1163924622 19:20328289-20328311 GAGAATAAAGAGAAGGCTCTGGG - Intergenic
1163951590 19:20592722-20592744 CAGAAAAAGCAGAATGGGCTGGG - Intronic
1163965025 19:20738373-20738395 CAGAAAAAGCAGAATGGGCTGGG + Intronic
1163983088 19:20920216-20920238 CAGAAAAAGCAGAATGGACTGGG + Intergenic
1164033461 19:21432437-21432459 CAGAAACAGGAGAACGGATTTGG + Intronic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164816720 19:31209851-31209873 CAGAATGGGGAGAAGGGGTTGGG - Intergenic
1164919955 19:32082056-32082078 CAGCATGAAGAGAAGGGAGTGGG + Intergenic
1164952491 19:32349079-32349101 CAGAATCAGAAGAAGGGTCTTGG + Intronic
1166165863 19:40987927-40987949 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1166226256 19:41397478-41397500 CAGAGTTAGGAGGTGGGACTGGG - Exonic
1168064259 19:53910117-53910139 GAGAATGTGGAGAAGGGACGAGG + Intronic
1168064539 19:53911580-53911602 AAGAATGTGGAGAAGGGACGAGG + Intronic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
925928913 2:8691962-8691984 CAGAAAAAGAAAAAGGGAGTAGG + Intergenic
926302253 2:11612791-11612813 GAGAATCAGGAGAAGGGGCACGG - Intronic
926387840 2:12355054-12355076 CAGACTAAGAAGGAGGCACTAGG + Intergenic
926425318 2:12734361-12734383 CTGAATAAAGTGAGGGGACTGGG + Intronic
926682339 2:15673528-15673550 CAGAAGAAGGCAAAGAGACTGGG + Intergenic
927400890 2:22708390-22708412 CAGGAGAAGGAGAAGTGAGTGGG + Intergenic
927631255 2:24776191-24776213 CAGGCTAAGGGGAAGAGACTGGG - Intergenic
927811021 2:26180152-26180174 CAGAACAAGGGGAAATGACTAGG - Intronic
928621627 2:33094471-33094493 TAGAATGAGGAGACTGGACTAGG + Intronic
929479263 2:42287913-42287935 CATAAGATGCAGAAGGGACTAGG + Intronic
929817227 2:45242919-45242941 CAAAATTAGGAGCAGGGCCTGGG + Intergenic
932276151 2:70453685-70453707 CAGAATTGGGACAAAGGACTGGG + Intronic
932297580 2:70639906-70639928 CAAAATAAGGTGATTGGACTAGG - Intronic
934475306 2:94589504-94589526 CAGAGCAAGGAGAGGGGAATTGG - Intronic
934605314 2:95690743-95690765 CAGAATCAGGAGAAGCCAGTAGG + Intergenic
935070175 2:99687140-99687162 CAGAACAAAGAGAAGGATCTAGG + Intronic
936259186 2:110943554-110943576 CAGAATGAGCAGAAGTCACTGGG + Intronic
936538771 2:113333296-113333318 CAGAATCAGGAGAAGCCAGTAGG + Intergenic
936587120 2:113767872-113767894 CAGGATAAGGAAATGGAACTTGG + Intergenic
938650114 2:133374337-133374359 GGGGATAAGGGGAAGGGACTGGG + Intronic
939620778 2:144416197-144416219 CAGAATGGGTAAAAGGGACTAGG - Intronic
939872109 2:147537375-147537397 CAGAATTAGAACAAGGGCCTGGG - Intergenic
940070210 2:149678537-149678559 TTGAATGAGAAGAAGGGACTAGG + Intergenic
940939736 2:159545187-159545209 GAGAGGCAGGAGAAGGGACTGGG - Intronic
941429189 2:165391507-165391529 CAAAATAAGAAGCAAGGACTAGG + Exonic
943853892 2:192763550-192763572 AAGAGTAGGGAGAAGGCACTGGG + Intergenic
945773949 2:214081465-214081487 CATAAAAAGAAGAAGGGACAGGG + Intronic
946415379 2:219537474-219537496 CAGAGTCAGGAGAAGGGGATGGG + Intronic
946564183 2:220944838-220944860 AAGATTGAGGAGAATGGACTGGG - Intergenic
946769432 2:223073622-223073644 CAGAATAATGAGAGGGCACTAGG + Intronic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947136086 2:226978124-226978146 CAGATTAAGGGCAAGTGACTTGG - Intronic
1169949618 20:11029021-11029043 AAGAAAAAGGAGAAAGGGCTGGG - Intronic
1170009469 20:11705770-11705792 CAGAATGAGGAGAGGGAAATGGG + Intergenic
1171966941 20:31537706-31537728 CAGAATGTGGAGAATGGAGTGGG + Intronic
1172443880 20:34983178-34983200 CAGGACCAGGAGCAGGGACTGGG - Intronic
1172964449 20:38824467-38824489 CAGAAGGAGAAGAAGGAACTGGG - Intronic
1172972779 20:38885604-38885626 CAAATTAAGGAGCAGGGATTTGG - Intronic
1173311282 20:41898227-41898249 CAGAGCCAGGAGAAGGGCCTTGG - Intergenic
1174569145 20:51488773-51488795 CAGGATAGGGACAAGGGACAAGG - Intronic
1176692583 21:9933971-9933993 CATAAAAAGGAAAAAGGACTTGG - Intergenic
1177008289 21:15700669-15700691 AAGAATAAGGAGCAGGGAGGTGG + Intergenic
1177058861 21:16345413-16345435 CATAATAAGAAGAAAGAACTAGG + Intergenic
1178150824 21:29791489-29791511 AAGAAGAAGGAGAAGGGAAGTGG + Intronic
1179359866 21:40695602-40695624 TCGAATAAGGAGAAGGGATGGGG - Intronic
1179359925 21:40696281-40696303 TCGAATAAGGAGAAGGGATGGGG - Intronic
1179648111 21:42787940-42787962 TAGAAAAAGCAGCAGGGACTTGG - Intergenic
1183023489 22:35046134-35046156 CAGAGTAAGGAGATGAGAATGGG - Intergenic
1183160437 22:36109692-36109714 CAGAATGATCAGAAGGGACGTGG - Intergenic
1183216906 22:36486601-36486623 CAGAGATAGGAGAAGGGTCTGGG + Intergenic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184857372 22:47153751-47153773 GAGAAGAAGGAGAAGAAACTGGG + Intronic
1185273796 22:49941259-49941281 CAGAAGAAGGAGAGGGTGCTGGG + Intergenic
949421990 3:3875571-3875593 CCGAATGAGGGCAAGGGACTGGG - Intronic
952401577 3:32968322-32968344 AAGAATAAGGAGAATGGTCAAGG + Intergenic
953201925 3:40785605-40785627 GAGAAGAAGGAGAGGGGAATGGG - Intergenic
953398946 3:42595726-42595748 CAAAAAAAGGAGCAGGGACCTGG - Intronic
953589379 3:44236865-44236887 CTGAATAAGGAGAAAGGAGGGGG - Intergenic
953637968 3:44678571-44678593 CAGTAAGTGGAGAAGGGACTGGG + Intergenic
955862760 3:63349735-63349757 CAAAATGAGTAGAAGGAACTTGG - Intronic
956088988 3:65643873-65643895 CAGAATGAGGAGCAGAGATTAGG - Intronic
956618642 3:71198465-71198487 GTGCATAAGGAGAAGGGCCTTGG + Intronic
957712629 3:83882470-83882492 CAGAATAAAGAGAAAAGACCTGG - Intergenic
957969843 3:87368672-87368694 CAGAGTAAAGAGGAGGCACTAGG + Intergenic
958417991 3:93899214-93899236 CAAAATATGGAGTAGGGACAGGG - Intronic
962265838 3:133943779-133943801 CAGAGGAAGGACAAGGAACTTGG - Intronic
962741303 3:138364283-138364305 GAGAAGCAGGAGGAGGGACTTGG + Intronic
965480179 3:169209163-169209185 CAAAATAAGGTGAAAGGAATGGG - Intronic
966030314 3:175338425-175338447 GAGAATAAGGAGATAGGAGTTGG + Intronic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
967233733 3:187365479-187365501 CAGAATAAGTAGAGTGGACTTGG + Intergenic
967418660 3:189249816-189249838 AAAAATAAGGTGAAGGAACTGGG - Intronic
967878495 3:194282536-194282558 CTGAATCTGGAGAAGGGGCTGGG - Intergenic
967979111 3:195054804-195054826 CAGAAGAATGAGAAATGACTTGG - Intergenic
968331259 3:197872559-197872581 AAGAAAAAGGAAAAGAGACTGGG + Intronic
969154815 4:5201269-5201291 CAGAAACAGGAGAAGGGACAAGG - Intronic
970334387 4:15019714-15019736 ATGAAAAAGGAGAAGGGAGTTGG + Intronic
972284049 4:37631323-37631345 CAGGGTGAGGAGAAGGTACTTGG - Intronic
973601276 4:52545250-52545272 CAGACTCAGGAGGAGGGGCTGGG - Intergenic
974571156 4:63650433-63650455 CAAAATAAGCAGATGGGTCTTGG + Intergenic
974988578 4:69058988-69059010 AATAATAAGGAGAAGGGTCAGGG + Intronic
975191897 4:71473845-71473867 TAGAAAAAGGAATAGGGACTGGG + Intronic
977476725 4:97519835-97519857 AAGAAAAAGGAGAAAGGACAAGG + Intronic
978229195 4:106377628-106377650 CAAAATAAGTAGAAAGAACTGGG + Intergenic
980365166 4:131794183-131794205 CATAAAAAGGAAAAAGGACTTGG - Intergenic
980833709 4:138163449-138163471 TGGAATAAGGAGATGGGAGTTGG + Intergenic
980951126 4:139378065-139378087 GAGCATTAGGAGAAGAGACTGGG + Intronic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
981612424 4:146609142-146609164 CAGAATACAGTGAAGGGTCTGGG - Intergenic
983272216 4:165575715-165575737 CAGAAGAAGGGGAAGTGACTGGG + Intergenic
983836140 4:172387743-172387765 CAGAAGAAGGTGAAGAGACAGGG - Intronic
983997807 4:174206575-174206597 TTCAATAAGTAGAAGGGACTGGG - Intergenic
985386560 4:189453721-189453743 CTGAAGAAGGAGAAGGGAATTGG + Intergenic
986074081 5:4316500-4316522 CAGAATCAGGAGGTGGGACTGGG - Intergenic
986658687 5:10039841-10039863 GAGACTAAGGAGGAGGTACTGGG + Intergenic
987122933 5:14784635-14784657 CAGAGTAAGGAGCAGGGTCATGG + Intronic
987238855 5:15972014-15972036 CAGAATGAGGCGAAGTGACCTGG + Intergenic
987908403 5:24108847-24108869 CAAACTAAGGAGAAAGGCCTTGG - Intronic
987910900 5:24143823-24143845 GAGAATAAGGAGACGTGAATGGG - Intronic
989405430 5:41056173-41056195 CAGGAAAAGGAGAAGAGACATGG + Intronic
990553263 5:56905113-56905135 CAGGATAATGAGAAGAGAGTGGG - Intergenic
990705372 5:58522690-58522712 AAGAATAAGGAGAAAAGCCTGGG - Intergenic
992799148 5:80280307-80280329 AAGTGTAAGGAGGAGGGACTGGG - Intergenic
993158810 5:84262302-84262324 AAGAAGAAGGAGAAAGGAATAGG + Intronic
993635725 5:90341215-90341237 CAGAATAAAAAGAAGAGACTTGG + Intergenic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
995735854 5:115298386-115298408 GAGAAGAAGGAGAAGGGAGAAGG + Intergenic
995978282 5:118069733-118069755 CAGAATAATGAGAAGCCAGTAGG - Intergenic
998628852 5:143876225-143876247 GAGAATGAAGAGAAGGGGCTTGG + Intergenic
999122806 5:149222535-149222557 CAAAATAAAGTGAAGAGACTTGG + Intronic
999637055 5:153634019-153634041 GAGAATAAAGAGTAGGGACCGGG + Intronic
1000407149 5:160900122-160900144 CAGGATCAGGAGAGGTGACTGGG - Intergenic
1001148495 5:169205340-169205362 CAGAATAAGGAGAATAGAATAGG - Intronic
1001286762 5:170429351-170429373 AAGAATAAGGAAGAGAGACTAGG - Intronic
1001827455 5:174756924-174756946 CAGAATAAGGTGGAAGGACCAGG + Intergenic
1002168063 5:177360244-177360266 CAGACTAGGGGGCAGGGACTAGG - Intronic
1002557077 5:180050621-180050643 TAGAATAAGGAGGAGGGAAATGG - Intronic
1003238856 6:4323816-4323838 CAGAATGAGTAGAAGGGATATGG - Intergenic
1003571683 6:7260409-7260431 CAGAACCAGGAGATGGGACATGG - Intergenic
1003953696 6:11142770-11142792 ATGAATAAGGAGAAGGGAGGGGG - Intergenic
1004179818 6:13371543-13371565 GAGAATTAGGCAAAGGGACTTGG + Intronic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004784741 6:18955121-18955143 ATGAAGAAGGAGAAGGGGCTGGG - Intergenic
1005323330 6:24676975-24676997 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1006273976 6:32986474-32986496 GAGAATAAGGGGAAGAAACTAGG - Intergenic
1006697478 6:35943474-35943496 CAGAATACAGAGAAGGGAGAAGG + Intergenic
1006942736 6:37763648-37763670 CACACCAAGGAGAAGGGAATCGG + Intergenic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1008788751 6:55203032-55203054 CTGAATAATGAAAAGGGAATAGG - Intronic
1008821784 6:55641577-55641599 CAGAATTGGAAGAAGGGAGTAGG + Intergenic
1008962502 6:57279977-57279999 CATAATAATGAGAAGGGAAGAGG + Intergenic
1010785489 6:79994867-79994889 CATAAGAAGGACAAGAGACTTGG + Intergenic
1011189452 6:84714481-84714503 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1011221430 6:85058315-85058337 CAGAAGAAGCAGAAGGGCTTGGG + Intergenic
1011489447 6:87875351-87875373 CAGAATTGGGAAAAGAGACTGGG + Intergenic
1011539526 6:88415412-88415434 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1013658553 6:112270906-112270928 CAGAAGCAGGAAAAGGGAGTGGG - Intergenic
1013879296 6:114875781-114875803 CAGAAAAAGAAGAGGAGACTGGG - Intergenic
1014484081 6:121977755-121977777 GAGAGTCAGGAGAAGGGAGTGGG + Intergenic
1015185080 6:130406746-130406768 CAAATTAAGGAGAGAGGACTGGG - Intronic
1017085021 6:150705714-150705736 GAGCATAAGGAGGAGGGAGTGGG - Intronic
1018301677 6:162409450-162409472 CAGAAAAGGGAGAGGGGTCTGGG - Intronic
1018412294 6:163563344-163563366 CGGAAAAATGAGAAGGGAGTAGG - Intronic
1020909457 7:14110346-14110368 GAGAATAAGCAGAAAGGAGTAGG - Intergenic
1021049750 7:15968012-15968034 CAGAAGGAGGAGAAGGGAAGTGG - Intergenic
1021193558 7:17649660-17649682 CAGACTAAAGAGATGAGACTTGG - Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1024382977 7:48721144-48721166 CAGACAAAGGAGGAGGTACTGGG + Intergenic
1025078525 7:55963622-55963644 AAAATTAAGGAGAAAGGACTGGG - Intronic
1025080586 7:55978880-55978902 GAGAATCAGCGGAAGGGACTTGG - Intronic
1027800612 7:82745119-82745141 CTGAATAAGAACAATGGACTTGG + Intergenic
1031102886 7:117504313-117504335 CAGAATCAACAGAAGGGATTTGG - Exonic
1031919952 7:127593199-127593221 CTGGGTAAGGAGAAGGGCCTAGG - Intronic
1031992836 7:128209220-128209242 CGGCATGAGGAGGAGGGACTGGG - Intergenic
1033158656 7:138978337-138978359 CTGAATAAGGTGAAGAAACTGGG + Intronic
1033400587 7:141020038-141020060 CAGAAAAAGAAGAAGGGACTAGG + Intergenic
1033823696 7:145163672-145163694 CAGAATAACAAGAAAGGAATAGG - Intergenic
1034205235 7:149308965-149308987 CAGAATAGGGAGAAGCCACCTGG + Intergenic
1034530941 7:151696175-151696197 ACGAATAAGGAGAAGGGAGGAGG - Intronic
1034984182 7:155497227-155497249 CAGAATCCTGAGAAGGGGCTGGG - Intronic
1035706828 8:1682133-1682155 CAGAATGAGGTGAAGGGTCAGGG - Intronic
1040530951 8:48265884-48265906 AAGAATATGCAGAAGGGGCTGGG - Intergenic
1041417574 8:57628877-57628899 CAGGATAAGCAGAAGGGAAGAGG - Intergenic
1041686375 8:60648746-60648768 CAGAAGATGGAGAAGGGAGGAGG - Intergenic
1042152419 8:65802573-65802595 CAGGATAATGGGAAGGTACTTGG + Intronic
1043007383 8:74836558-74836580 AAAAAAAAAGAGAAGGGACTTGG + Intronic
1044973003 8:97638188-97638210 CAGTGGAAGGAGAAGGAACTAGG + Intergenic
1045230803 8:100304678-100304700 TAGAATCAGGAGAGGCGACTAGG - Intronic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045762171 8:105622722-105622744 CAGAATGAAGACAAGTGACTTGG + Intronic
1046207662 8:111022631-111022653 CAGAGTAAGCAGATTGGACTGGG - Intergenic
1046348036 8:112962793-112962815 GAGAATAGGGAGAATGGACCTGG - Intronic
1046584049 8:116129678-116129700 GAGAAGAGGGAGAAGGGGCTGGG + Intergenic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047747536 8:127855925-127855947 GAGATTATGGAGAAGGGAGTGGG - Intergenic
1047861505 8:128972233-128972255 AAGAAATAGGATAAGGGACTTGG + Intergenic
1048968202 8:139629069-139629091 CCTCATAATGAGAAGGGACTGGG - Intronic
1049434826 8:142581644-142581666 CCGACCAAGGAGAAGGGACCAGG + Intergenic
1052552262 9:29967266-29967288 CAGAAGAGGGAGAAGGGTTTTGG - Intergenic
1052790454 9:32870613-32870635 CAGAACCAGGGAAAGGGACTGGG - Intergenic
1052854741 9:33400277-33400299 CAGAGCAAGGAGAGGGGAATTGG + Intronic
1053134529 9:35641973-35641995 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1053286445 9:36852382-36852404 CTCAGAAAGGAGAAGGGACTTGG + Intronic
1053629525 9:39920036-39920058 CATAAAAAGGAAAAAGGACTTGG - Intergenic
1053682761 9:40496558-40496580 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1053776242 9:41543511-41543533 CATAAAAAGGAAAAAGGACTTGG + Intergenic
1054214362 9:62330666-62330688 CATAAAAAGGAAAAAGGACTTGG + Intergenic
1054280953 9:63128371-63128393 CAGAGCAAGGAGAGGGGAATTGG - Intergenic
1054295861 9:63332072-63332094 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054365491 9:64334979-64335001 CATAAAAAGGAAAAAGGACTTGG - Intergenic
1054393878 9:64636567-64636589 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054428527 9:65141780-65141802 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054501852 9:65879765-65879787 CAGAGCAAGGAGAGGGGAATTGG - Intronic
1054673121 9:67824692-67824714 CATAAAAAGGAAAAAGGACTTGG - Intergenic
1054968209 9:71054156-71054178 CAGATTAAAGATAAGGAACTTGG + Intronic
1055323270 9:75102677-75102699 CAGAATAAAGAGCAGGGTCTGGG - Intronic
1055339844 9:75269580-75269602 CACAAAAAGGAGAAGTGACTGGG - Intergenic
1055913824 9:81379954-81379976 CAGATTAGGGAGAAGGGAAAGGG + Intergenic
1056271583 9:84953054-84953076 CAGCACCAGGAGAAGGGGCTGGG - Intronic
1057432623 9:95007803-95007825 CAGAATAGGGGGAAGGCCCTTGG - Intronic
1057878769 9:98777502-98777524 CAGCATAAGGATGAGTGACTGGG + Intronic
1059067610 9:111102181-111102203 CAGGATAAGGAGTGGGGCCTAGG + Intergenic
1059621511 9:116010991-116011013 CTGAAGAAGGTGAAGGGACCAGG + Intergenic
1060106400 9:120876199-120876221 GAGAAAAAGGAGATGGGAGTGGG - Intronic
1060341746 9:122783384-122783406 AATAATAAGGAGATAGGACTAGG + Intergenic
1060647113 9:125290556-125290578 CCGAATAAGGATAAGGGAAGAGG + Intronic
1060831736 9:126721869-126721891 CAGAACAAGGAAACGGGACACGG - Intergenic
1061216430 9:129224532-129224554 CTGAGTGAGGAGAAGGTACTAGG + Intergenic
1061431517 9:130534303-130534325 CAGAACAGGGAGAAGGTTCTGGG - Intergenic
1061922464 9:133789521-133789543 CAGAAGACCGGGAAGGGACTGGG + Intronic
1062271820 9:135713355-135713377 CAGAACAAGGAGCAGGGTTTGGG + Intronic
1187317497 X:18209786-18209808 CAGAAAAAGGACATGGGATTGGG + Intronic
1187435131 X:19260969-19260991 GAGAACCAGGAGAAGGGCCTGGG - Intergenic
1189128972 X:38478967-38478989 CTGAGAAAGGTGAAGGGACTGGG + Intronic
1189481340 X:41394451-41394473 CAGAAGAAGGAGGAGGGATTAGG + Intergenic
1190618665 X:52263845-52263867 CAGAAAAACGTGAAGAGACTAGG + Intergenic
1190939500 X:55026865-55026887 TTGAGGAAGGAGAAGGGACTAGG + Intronic
1191089321 X:56603115-56603137 CAGAAAATGTAGAAGTGACTTGG - Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193246466 X:79236416-79236438 GGGCATAAGCAGAAGGGACTTGG - Intergenic
1195699250 X:107690077-107690099 CAGAACAGGGAGAAAGGCCTTGG + Intergenic
1196812256 X:119638094-119638116 AAGAATAAGGGGAAAGAACTAGG + Intronic
1197109345 X:122755126-122755148 CACAATAAGGAGAACAGAATAGG + Intergenic
1202071055 Y:20991920-20991942 AAGAATAAGAAGAATGGTCTGGG + Intergenic