ID: 1149021500

View in Genome Browser
Species Human (GRCh38)
Location 17:51971183-51971205
Sequence TCATTTCTAGGCACTCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149021500_1149021503 8 Left 1149021500 17:51971183-51971205 CCATGAGGAGTGCCTAGAAATGA 0: 1
1: 0
2: 1
3: 17
4: 180
Right 1149021503 17:51971214-51971236 TAAAACATGCTCATTTTTACAGG 0: 1
1: 0
2: 3
3: 42
4: 873

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149021500 Original CRISPR TCATTTCTAGGCACTCCTCA TGG (reversed) Intronic