ID: 1149023553

View in Genome Browser
Species Human (GRCh38)
Location 17:51998196-51998218
Sequence CACCCTAGACTGCTACATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149023547_1149023553 24 Left 1149023547 17:51998149-51998171 CCAGGTCAAAGCCTATGTTCTTT 0: 1
1: 0
2: 1
3: 22
4: 256
Right 1149023553 17:51998196-51998218 CACCCTAGACTGCTACATACTGG 0: 1
1: 0
2: 1
3: 3
4: 49
1149023548_1149023553 13 Left 1149023548 17:51998160-51998182 CCTATGTTCTTTACAGAACCATG 0: 1
1: 0
2: 0
3: 20
4: 233
Right 1149023553 17:51998196-51998218 CACCCTAGACTGCTACATACTGG 0: 1
1: 0
2: 1
3: 3
4: 49
1149023546_1149023553 25 Left 1149023546 17:51998148-51998170 CCCAGGTCAAAGCCTATGTTCTT 0: 1
1: 0
2: 2
3: 26
4: 245
Right 1149023553 17:51998196-51998218 CACCCTAGACTGCTACATACTGG 0: 1
1: 0
2: 1
3: 3
4: 49
1149023549_1149023553 -5 Left 1149023549 17:51998178-51998200 CCATGTCCTTTGTTCACCCACCC 0: 1
1: 0
2: 2
3: 36
4: 252
Right 1149023553 17:51998196-51998218 CACCCTAGACTGCTACATACTGG 0: 1
1: 0
2: 1
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149023553 Original CRISPR CACCCTAGACTGCTACATAC TGG Intronic
900374138 1:2345619-2345641 CACCCTAGCCGGCAACATAGGGG + Intronic
913116316 1:115700927-115700949 CACCCTAGACTGCCATGTTCAGG + Exonic
1073813389 10:107176532-107176554 CAGCCTAGGCAGCAACATACTGG - Intergenic
1074638824 10:115354451-115354473 CAACCTAGAATACTGCATACAGG - Intronic
1081988312 11:47323600-47323622 CTCCCTAGACTGTTTCCTACAGG - Intronic
1086847188 11:91765582-91765604 CACCCAAGACTGAAACATTCTGG + Intergenic
1101038848 12:100733545-100733567 CAACCCAGACAGCTACACACAGG - Intronic
1106373427 13:29160141-29160163 CACCACAGACTGCTACTTAGCGG + Intronic
1113007925 13:105728708-105728730 CACCCCAGACTGCTTTATAGAGG - Intergenic
1118824766 14:69370043-69370065 CTCCCTAGACTGCTTCTGACTGG - Intergenic
1119961539 14:78863331-78863353 CACCCTGGATAGCTCCATACGGG - Intronic
1132056489 15:98654215-98654237 CACTGTAGACTGTGACATACAGG + Intronic
1132093954 15:98968415-98968437 CACAGTTGAGTGCTACATACAGG + Exonic
1132133909 15:99313724-99313746 CAACCAAGAATTCTACATACAGG - Intronic
1138551679 16:57752132-57752154 CACCCCAGACAGCGACAGACCGG - Intronic
1138621705 16:58216650-58216672 CACCCTTTACTGCTACCTGCTGG + Intergenic
1146408730 17:32563812-32563834 CACCTCAAACTGCTACATATTGG + Intronic
1149023553 17:51998196-51998218 CACCCTAGACTGCTACATACTGG + Intronic
1162822278 19:13230140-13230162 CACCCGAGACTCCTCCATCCTGG - Exonic
1164778250 19:30871682-30871704 CACCCTAGACTGCTGTATACAGG - Intergenic
927230671 2:20821886-20821908 CCCCCTAGAATGCTACATGCTGG + Intronic
929524467 2:42687694-42687716 CACCCTAAAGGGCAACATACCGG - Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932842642 2:75097908-75097930 CACCACAGAATGCTACAAACTGG - Intronic
933620111 2:84528940-84528962 CCTCCTAAACTGCCACATACTGG + Exonic
941870979 2:170385332-170385354 CCCCCTAGACAGCTTCAGACTGG - Intronic
947410434 2:229832527-229832549 CACACTATAATGCTACTTACAGG + Intronic
948923696 2:241080842-241080864 CACCCTGGACTGGTCCACACAGG - Intronic
1169168355 20:3442562-3442584 CACCCTGGACTTCTACATTAGGG + Intergenic
1177444282 21:21171587-21171609 CACCCTTGACTGCCACAGACTGG + Intronic
1180122366 21:45762359-45762381 CACCCGAGACTGGGACATGCAGG - Intronic
1182753784 22:32662025-32662047 CTCCCTAGACTGGTAGATAAGGG - Intronic
953332065 3:42061970-42061992 CACCCGAGACAGCTGCATTCTGG - Intronic
955080114 3:55650389-55650411 CACCCTGGCCTGCTTCATGCTGG + Intronic
956748067 3:72325140-72325162 GTCCCTTCACTGCTACATACTGG - Intergenic
959212954 3:103412140-103412162 CACCCAAGACTTCTACAATCTGG + Intergenic
968083719 3:195864457-195864479 CACCCGAGACAGCGACAGACAGG + Intronic
968083727 3:195864522-195864544 CACCCCAGACAGCGACAGACAGG + Intronic
968083774 3:195864912-195864934 CACCCGAGACAGCGACAGACAGG + Intronic
968083782 3:195864977-195864999 CACCCGAGACAGCGACAGACAGG + Intronic
973307283 4:48667171-48667193 CACCCCATCCTGCTACATATGGG - Intronic
974488867 4:62538027-62538049 CACTCTAGACTTCTACATGGAGG + Intergenic
977566834 4:98589142-98589164 CACCCTAGATTAGTACATGCTGG + Intronic
977621937 4:99147960-99147982 CACCCTACACTTCTACATTATGG + Intronic
996801870 5:127412918-127412940 CAGGCTAGCCTGCTAGATACTGG - Intronic
1004921776 6:20382555-20382577 CACCTTATACTGCTACAAATAGG + Intergenic
1012457114 6:99419422-99419444 TAAGGTAGACTGCTACATACTGG + Intronic
1015722579 6:136259138-136259160 CACCCTAGCCTACTACACTCTGG + Exonic
1032483330 7:132263937-132263959 CACCCTAGAAAGCTTGATACAGG - Intronic
1052338787 9:27345066-27345088 CACCCCATGCTGCTGCATACTGG - Intronic
1057712702 9:97461713-97461735 CACCCTGGACTGGTACCTCCAGG - Intronic
1190579606 X:51879433-51879455 CACCCTAGATTTCTACATATAGG - Intronic
1191126577 X:56961959-56961981 CATTCTAGACTCCTACATCCGGG - Intergenic
1197871412 X:131065939-131065961 CAGCCTAGACTGCTGCAAAGAGG - Intronic