ID: 1149024331

View in Genome Browser
Species Human (GRCh38)
Location 17:52008491-52008513
Sequence GGTTAAGTATGTTAATTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149024331 Original CRISPR GGTTAAGTATGTTAATTTAA TGG Intronic
905152514 1:35942745-35942767 GGTTAAGATGGTAAATTTAATGG - Intronic
905501183 1:38438905-38438927 GTTTAAGTATTTCAATTAAAAGG - Intergenic
906971342 1:50517932-50517954 GGAAAAGTAAGTTTATTTAATGG - Intronic
908572606 1:65425090-65425112 CTTTAAGAATGTTAATTTTATGG - Intronic
908650254 1:66325137-66325159 GAGTAAGTATGCTAACTTAAAGG + Intronic
909531597 1:76688140-76688162 GGTTGAGTTTCTTAATTTATGGG + Intergenic
909764244 1:79334942-79334964 GGTTTAATATAGTAATTTAATGG - Intergenic
911560291 1:99396965-99396987 GGTTAAGTATGAAATGTTAATGG + Intergenic
911735255 1:101329825-101329847 GATAAAGTATATTAATTAAAGGG - Intergenic
913269159 1:117075941-117075963 GGTTAAATATGTTCATGTGAAGG + Intronic
915203455 1:154251387-154251409 GGGTAAGTTTGGAAATTTAAAGG + Intronic
917084449 1:171291930-171291952 TGTTAAGTATGTTTTTGTAATGG - Intergenic
918431785 1:184468443-184468465 GGATATGTATGTAAATTTTAAGG + Intronic
920705267 1:208245860-208245882 GGGTAAATATGATAATTTATTGG - Intergenic
922009988 1:221573747-221573769 GGTCAAGTGTGTGAATTTTAAGG + Intergenic
923910206 1:238432461-238432483 GCTTAAGGATGTGATTTTAATGG - Intergenic
924314564 1:242782389-242782411 AGTTAACTATTTCAATTTAAAGG + Intergenic
1063025096 10:2170342-2170364 GGTGAAGGATGTAAATTTAATGG - Intergenic
1063604772 10:7513362-7513384 AGTTAAATATGTGAACTTAATGG + Intergenic
1063682435 10:8202021-8202043 GTTTTAGTGTGTAAATTTAAGGG + Intergenic
1066392966 10:34993630-34993652 ATTTAAGTATATAAATTTAAGGG + Intergenic
1068206212 10:53857790-53857812 GGTTAAATGAGCTAATTTAATGG + Intronic
1068839535 10:61594622-61594644 AGTTAGGAATTTTAATTTAATGG - Intergenic
1070241309 10:74684289-74684311 TGTTAAATATATGAATTTAATGG + Intronic
1074672342 10:115806101-115806123 GTTTAAGTAAGTTCTTTTAAAGG - Intronic
1076143415 10:128097341-128097363 GGTTAAAAATGTTCATTTAAGGG - Exonic
1077864777 11:6212994-6213016 AATTAAGTATGTTGAGTTAAGGG - Intronic
1077900932 11:6488039-6488061 GGCTAAATATGTTAATTTCCAGG - Intronic
1078655826 11:13238236-13238258 GGTTAAGTATGGAAATGTCAGGG + Intergenic
1079836117 11:25335094-25335116 CGATAAGTATGTTAAAATAAAGG - Intergenic
1080088975 11:28321094-28321116 GATTTGATATGTTAATTTAAAGG - Intronic
1081295978 11:41389893-41389915 TCTTAAGTATGTTAATTTTGGGG - Intronic
1082218723 11:49606125-49606147 GTTTAAGTAATTTTATTTAAAGG + Intergenic
1085079998 11:73626013-73626035 GGCCAAGAATGTTATTTTAATGG - Intergenic
1085655895 11:78314538-78314560 GCTTTAGTATCTTAATATAATGG + Intronic
1086630850 11:89017997-89018019 GTTTAAGTAATTTTATTTAAAGG - Intronic
1086851307 11:91812433-91812455 GATTCAGTATATTAATTTCATGG - Intergenic
1087503314 11:98987797-98987819 AGTTAAGTATGTATATTTATGGG - Intergenic
1088398898 11:109400907-109400929 GGTTAAGTATGTACAATCAAAGG - Intergenic
1090508708 11:127348250-127348272 GGAGAAGAATGTTAATTTCATGG + Intergenic
1091159416 11:133406247-133406269 GGATAAGGATCTAAATTTAAGGG + Intronic
1091864321 12:3818107-3818129 GCTAAAGTATGTGAATTTATAGG - Intronic
1094173682 12:27520965-27520987 ATTTCAGTATGTTTATTTAAGGG + Intergenic
1096879678 12:54657717-54657739 GGTTAAGTGTGTTAATCTAAAGG + Intergenic
1097936162 12:65254266-65254288 TGTTAAGTATATTACTGTAAAGG - Intergenic
1098425168 12:70355519-70355541 GGTTAAAAATGAAAATTTAAAGG - Intergenic
1098742851 12:74196417-74196439 TCTTAAGTCTGTTAATTTACAGG - Intergenic
1099269192 12:80486146-80486168 GGTTAATAATGAGAATTTAATGG + Intronic
1100393757 12:94166728-94166750 GTTTGAGAATGTTGATTTAATGG + Intronic
1100618757 12:96251554-96251576 AGTTAAGTATGTAAATGTAAAGG + Intronic
1102330431 12:112024561-112024583 TGTTAAGTATTTCAATTTTAAGG + Intergenic
1102521345 12:113478994-113479016 GGTGAAGTATCTTATTTTAGAGG + Intergenic
1102983774 12:117262795-117262817 GGTTAACTAAGTTGATTTAACGG - Intronic
1108601286 13:51997477-51997499 GGTGAAGTATTTCAATTTCATGG - Intronic
1108812527 13:54245983-54246005 GGTGAAGGATGTTAAGTTAGGGG - Intergenic
1108978341 13:56478678-56478700 CATTAAGTATGTTTATTTAAAGG + Intergenic
1113432043 13:110259741-110259763 ATTTAATTATATTAATTTAATGG + Intronic
1114007332 14:18329463-18329485 CATTAAGTATGATAATTTTAGGG - Intergenic
1116375988 14:44201713-44201735 GGTTAATTATGATAGGTTAAAGG - Intergenic
1119047457 14:71332022-71332044 GGTTGAGTATATTATTTGAAGGG + Intronic
1120599185 14:86480008-86480030 GGTGGAGTATGATAATTTTAGGG - Intergenic
1122574032 14:102730251-102730273 GGTTAAGTTTGCAAATATAATGG + Exonic
1124036863 15:26061641-26061663 GGGTAAGACTGCTAATTTAATGG + Intergenic
1124177996 15:27444362-27444384 GGTTAAATATTTTAATTTGGGGG - Intronic
1124950935 15:34319939-34319961 AATTAAGTATGTTATTTTAAGGG - Intronic
1125155144 15:36577551-36577573 GGTTAAGGATTTTTTTTTAAAGG - Intergenic
1126781363 15:52141648-52141670 TGTTAAGTCTGTGAATCTAAGGG - Intronic
1127422565 15:58821269-58821291 CTTTAAATATGTTAATTTATAGG - Intronic
1128020889 15:64389317-64389339 GTTCAAGTAGGTTATTTTAATGG + Intronic
1131815803 15:96219952-96219974 GGTTAAGGATGTTAAGATAAGGG + Intergenic
1131917541 15:97286530-97286552 GGTTAAGAATGATGAATTAAAGG + Intergenic
1135837750 16:25842562-25842584 GGTTAATTCAGTTAATTTACTGG - Intronic
1136494043 16:30630724-30630746 GATTAAGTGTGATAATTAAAGGG + Intergenic
1139662710 16:68432521-68432543 GATGTGGTATGTTAATTTAAAGG - Intronic
1141917194 16:87107325-87107347 AGTGGAGTATGTTAATTTCAAGG + Intronic
1144815190 17:18029165-18029187 GGTTAATTAGGTTAATTAATTGG - Intronic
1145178137 17:20719778-20719800 GGTTCATTCTGTTTATTTAAGGG + Intergenic
1147768833 17:42854254-42854276 GATGAAGTATTTTAATTTACAGG + Intronic
1149024331 17:52008491-52008513 GGTTAAGTATGTTAATTTAATGG + Intronic
1149837826 17:59929681-59929703 GGTTTATTCTGTTTATTTAAGGG + Intronic
1150081513 17:62243863-62243885 GGTTCATTCTGTTTATTTAAGGG - Intergenic
1152023824 17:77796170-77796192 ATTTAAGTATGTACATTTAATGG + Intergenic
1154178186 18:12102767-12102789 GGTTTAGTGTGTTATTATAAAGG + Intronic
1156707702 18:39902982-39903004 GTTTAAATAAGGTAATTTAAAGG + Intergenic
1157851696 18:51059466-51059488 AATTAAGGATGTTTATTTAATGG - Intronic
1158216663 18:55107459-55107481 GGCTATGTATTTTAATTTCAAGG - Intergenic
1158773145 18:60545925-60545947 TGTTAAGTATATTTAATTAATGG + Intergenic
1164548960 19:29191913-29191935 GCATAATTATGTTATTTTAATGG - Intergenic
1165002186 19:32773827-32773849 GGTTAAACATATTAACTTAAAGG + Intronic
1167190107 19:47981542-47981564 GCTTAACTTTTTTAATTTAATGG - Intronic
925823886 2:7827964-7827986 TGTTAAAAATTTTAATTTAAAGG - Intergenic
926505546 2:13710278-13710300 GATTAAGTATGTAAAGTTTAAGG + Intergenic
926522928 2:13939644-13939666 GCTTAAATATGTAAATTTAAAGG + Intergenic
926784368 2:16506084-16506106 GGATCAGTATGTGCATTTAAAGG + Intergenic
928350656 2:30550708-30550730 GATTGAGTATGTAAATGTAAAGG - Intronic
929001265 2:37349228-37349250 ACTGAAGTATGTTAATTAAATGG + Intronic
930739507 2:54815908-54815930 AGTGAAGTATGTAAATTAAAGGG - Intronic
930827467 2:55708899-55708921 GGTTAACGATGATAATGTAAAGG - Intergenic
930925427 2:56812190-56812212 GTCTGAGTATGTTCATTTAAGGG - Intergenic
930934025 2:56924972-56924994 GGATAAGTATGGTATGTTAATGG + Intergenic
931576672 2:63724277-63724299 TTTTAAGTCTATTAATTTAATGG - Intronic
932325305 2:70855597-70855619 GGGTAAATATTTTAATTTAAGGG - Intergenic
933320168 2:80763851-80763873 GGTAGAGTATGTTAAGTTAAAGG + Intergenic
933817731 2:86081572-86081594 GGTGAAATAAGTTAATTAAAGGG + Intronic
935481021 2:103589848-103589870 AGTTTAGTATGCTATTTTAATGG + Intergenic
936667452 2:114613263-114613285 GGTTATGGATATTAAGTTAATGG + Intronic
937655923 2:124376238-124376260 GCTTAATTATGTTAAATAAATGG - Intronic
937818745 2:126284359-126284381 GGTTCTATATATTAATTTAAGGG + Intergenic
938857369 2:135327534-135327556 GACTAAGTATATTAAATTAATGG - Intronic
939538333 2:143461322-143461344 GTTTAAGGATTTTAATGTAAAGG - Intronic
939565191 2:143778865-143778887 GGCAAAGTATCTTAATTTCATGG - Intergenic
939784280 2:146490214-146490236 TGATAAGAATGTTAATTAAATGG + Intergenic
941376147 2:164733282-164733304 GGTTAAGAATATTAACATAATGG + Intronic
941711593 2:168719899-168719921 AGTTAAATATGTTATTTAAATGG - Intronic
943184790 2:184594161-184594183 GGTTAAATAAGTGAAGTTAAGGG + Intergenic
943995280 2:194755990-194756012 GGTTTAGTATGTGAAATTAATGG - Intergenic
945095577 2:206215939-206215961 GGTTAAGTTTCTTAAGATAATGG - Intronic
1169822701 20:9730224-9730246 TCTTAAGTATTTTAATTTATAGG - Intronic
1170183392 20:13559212-13559234 CCTTCAGTATGTTAAATTAAGGG + Intronic
1171416857 20:24987735-24987757 TTTTAAGTAGGTTAATTTTATGG + Intronic
1173435420 20:43028115-43028137 GAACAAGTATGATAATTTAAAGG - Intronic
1176911353 21:14568934-14568956 GGTTAATTTTGTTATTTTGAAGG - Intronic
1176997446 21:15572395-15572417 TATTTAGTATGTTAATTTTATGG + Intergenic
1177104255 21:16934736-16934758 CGTTAATTAGATTAATTTAATGG + Intergenic
1177903399 21:26945645-26945667 GGTGAAGCATGTAATTTTAAAGG + Intronic
1179079470 21:38157438-38157460 GGGTAATTCTGTTAACTTAAAGG + Intronic
1180431839 22:15260270-15260292 CATTAAGTATGATAATTTTAGGG - Intergenic
949277306 3:2299603-2299625 TATTAAGTATGTTTATTTTAGGG + Intronic
950102137 3:10364349-10364371 GGTCAAGTTTGTAAATTTTATGG + Intronic
953424952 3:42787803-42787825 ATTTAAGTAAGTTTATTTAATGG - Intronic
955005955 3:54969089-54969111 CCTAAAGTATCTTAATTTAAAGG - Intronic
955146082 3:56321237-56321259 CTTTAAGTATGCAAATTTAAAGG + Intronic
957148957 3:76460299-76460321 TTTTGAGTATGTTAATATAATGG - Intronic
957997837 3:87712557-87712579 GGGAAAGTAAGATAATTTAAAGG + Intergenic
959143578 3:102516670-102516692 GATTAAGTATTTTATTTTAATGG + Intergenic
960012787 3:112851454-112851476 GGTTAAATGTCTTAATTAAAAGG + Intergenic
960112053 3:113854787-113854809 TATTAAATATGTTAATTTATTGG - Intronic
960784528 3:121357341-121357363 GGATAAGCAAGTTAATTTAAAGG + Intronic
961429299 3:126869815-126869837 TTTTAAGTTTGTTAATTTGATGG + Intronic
962990744 3:140574943-140574965 GGTCATGGATGTTAATATAAAGG + Exonic
963093097 3:141505006-141505028 GCTTAAATATTTTAATTGAAAGG + Intronic
963098446 3:141572537-141572559 GGTCAAGTATGTTATATTATTGG + Intronic
964011344 3:151895583-151895605 GCCTAAGTATGCTGATTTAACGG - Intergenic
964114413 3:153120803-153120825 TTTTAAGTATGGTAAATTAAAGG + Intergenic
964658357 3:159092955-159092977 GGTTTAGACTGTTAATTTATTGG + Intronic
964907120 3:161730675-161730697 GCTTAAGTATTTGAGTTTAAAGG + Intergenic
965042139 3:163522391-163522413 GATTAAGTATTTTGATCTAAAGG - Intergenic
965146980 3:164918089-164918111 AGTTAACAATGTTAATTTATGGG - Intergenic
965895847 3:173574604-173574626 CATTAAGTATGTTAGTTTCATGG - Intronic
967395178 3:189000473-189000495 GGGTAAGCATTTTAAATTAAAGG - Intronic
967493518 3:190119359-190119381 GGTTAAGAGTGTCAATTTGAAGG + Intronic
967637616 3:191822191-191822213 ACTTAAGTATGTTTTTTTAATGG - Intergenic
968865117 4:3204430-3204452 GGGTATGTTTGTTAATTTGAGGG + Intronic
971776251 4:30969861-30969883 GGCTTAGTAAGATAATTTAAGGG - Intronic
972094316 4:35329613-35329635 GGTTAATTATGTTTCTTTATAGG + Intergenic
977837352 4:101660994-101661016 GGTTAATGATGTTTCTTTAAAGG + Intronic
978227762 4:106358592-106358614 GGTCAAGTATTTTAAGTAAATGG + Intergenic
978705903 4:111710790-111710812 GGTTAAGAATGTTAAGATGATGG - Intergenic
979219573 4:118206572-118206594 GGTTAAGAAGTTTAATTTGATGG + Intronic
980431788 4:132709665-132709687 GGTTAATTTTTTTAAGTTAAAGG + Intergenic
981566777 4:146110153-146110175 GGTTAATTATGGTGAGTTAAGGG + Intergenic
981895344 4:149792454-149792476 TGTAAAGTATTATAATTTAAAGG + Intergenic
983309788 4:166044620-166044642 GTTGAACTTTGTTAATTTAATGG + Intronic
983348121 4:166553402-166553424 GGTTACCTATGTTAATTTAATGG + Intergenic
983653849 4:170060230-170060252 GTTTAAGAATTTTATTTTAAAGG + Exonic
984018406 4:174454219-174454241 GATTGAGTATCTTAATTTCATGG - Intergenic
985150971 4:186946671-186946693 GGCTAAGTGAGATAATTTAAAGG + Intergenic
986529871 5:8725344-8725366 GGTTAAGTATTTTTATTAAGTGG - Intergenic
986529949 5:8726197-8726219 GGTTAAGTATTTTTAGTAAATGG - Intergenic
986780006 5:11056619-11056641 GCTTAAGTATTTTAAATTCATGG + Intronic
988342826 5:29997111-29997133 GGTTATGAAAGTTAATTAAATGG + Intergenic
988368831 5:30340109-30340131 GGTTAATTACCTTAATTTATAGG - Intergenic
990088348 5:52007488-52007510 GGGAAGGTATGTTATTTTAAAGG - Intergenic
990129326 5:52560710-52560732 GGATATTTATTTTAATTTAATGG + Intergenic
991774409 5:70070696-70070718 TGGGAAGTATGTTAATTTCATGG + Exonic
991853704 5:70946121-70946143 TGGGAAGTATGTTAATTTCATGG + Exonic
992283999 5:75213742-75213764 GGTTAATTGTGTTAATTTAGAGG + Intronic
993958455 5:94266102-94266124 GTTTTACTATGTTAATTTCAGGG - Intronic
994326298 5:98449862-98449884 AATTAAATATGTTCATTTAATGG + Intergenic
994723322 5:103405631-103405653 GATAAAGTTTTTTAATTTAATGG - Intergenic
995465065 5:112443128-112443150 AGTTAAGTATTTTTATTCAATGG - Intergenic
996493126 5:124122701-124122723 AGCTAACTATGTTAGTTTAATGG + Intergenic
997011599 5:129884520-129884542 GGTGTAGTAGGTTATTTTAAGGG + Intergenic
997166129 5:131661567-131661589 GATAAAGAATGTTAATTTGATGG + Intronic
998986487 5:147763604-147763626 GGGTAAATATTTTAATTTAGAGG + Intronic
1002066272 5:176653418-176653440 GGTTAAGTTTGTAAGTTTGAGGG - Intronic
1002458257 5:179358422-179358444 GCTTCAGTATGTGAATTTGAAGG - Intergenic
1003510411 6:6774855-6774877 GTTTAAGTAAGTTGATTTATTGG - Intergenic
1005453653 6:25998575-25998597 GTTTAAGCATGTTATATTAAAGG - Intergenic
1006253648 6:32812205-32812227 GCTTAGGTCTGTTAATTTATTGG - Intergenic
1008216375 6:48794675-48794697 GGTTAAGTATCTTTTTTCAAAGG + Intergenic
1008987652 6:57564217-57564239 GGTTATGTAAGTTAAGTTGAAGG + Intronic
1009176256 6:60462822-60462844 GGTTATGTAAGTTAAGTTGAAGG + Intergenic
1010109225 6:72204933-72204955 TGTTAAGTTTATTGATTTAATGG + Intronic
1011621024 6:89242711-89242733 GGATATGCATTTTAATTTAAAGG - Intergenic
1012049597 6:94324294-94324316 GGTTAAAAATTTTTATTTAAGGG + Intergenic
1012427466 6:99130173-99130195 GGTTGAATATGTTAACTTACTGG - Intergenic
1013649135 6:112175864-112175886 AGTTAAGTATGTTATATAAAAGG - Intronic
1013994799 6:116295718-116295740 GTTTAAGTAGGTTTATTTAAGGG + Intronic
1014975287 6:127873587-127873609 GGTTAATTATTTTAATTTTATGG - Intronic
1015079748 6:129209555-129209577 AGTACAGTATGTTTATTTAAAGG + Intronic
1015936530 6:138410355-138410377 GGTTCAGTATTTGATTTTAAGGG + Intronic
1016568703 6:145488872-145488894 GGTTAAGAAATTTTATTTAATGG - Intergenic
1016604252 6:145900994-145901016 GGTTAAGTATGTGAAGTGATGGG + Intronic
1016719618 6:147280503-147280525 TGTTAAGTATTTTGATTTGAAGG + Intronic
1021566414 7:22021088-22021110 TCTTAAGTTTCTTAATTTAATGG - Intergenic
1022335945 7:29422167-29422189 GGTCAAGTGTGTTAATTTTAAGG + Intronic
1022545840 7:31188124-31188146 GGTTTTGTTTGTTTATTTAAGGG - Intergenic
1022851026 7:34262382-34262404 GGTTAATTATGGTAATTAATAGG + Intergenic
1023655715 7:42418721-42418743 TGTTCATTATGTTAATTTGATGG - Intergenic
1026668119 7:72362129-72362151 TCTTAAGTATGTTAATTTTGAGG + Intronic
1028018081 7:85739797-85739819 GGTGGAGTCTGTTATTTTAAAGG + Intergenic
1030253438 7:107478203-107478225 TGTTTTGTGTGTTAATTTAAGGG + Intronic
1031075175 7:117205131-117205153 GGTTAAATATTTGATTTTAATGG - Intronic
1031142462 7:117958805-117958827 AGTTATGTATTTTAATTTCATGG - Intergenic
1033075547 7:138246990-138247012 GGAGAAGTACGTTATTTTAAGGG - Intergenic
1033893953 7:146049146-146049168 GATTAAGTATGTAACTTAAAAGG + Intergenic
1034079082 7:148260041-148260063 GGTTAAGTGTAATAATTTCAAGG - Intronic
1035143517 7:156788400-156788422 GGTTAAGTATCATAAATAAAAGG - Intronic
1035171092 7:157017926-157017948 GGGTAATTATTTTAATGTAAGGG - Intergenic
1037422245 8:18715301-18715323 GGGTCATTATGTTAATTTAGTGG - Intronic
1040321862 8:46314878-46314900 GGTTAACTTTGTTAACTGAATGG + Intergenic
1043934239 8:86125146-86125168 GGTTGAGGATGTTAAGGTAATGG + Intronic
1044364031 8:91322441-91322463 GGTCAAATATTTGAATTTAAAGG - Intronic
1044540261 8:93400902-93400924 GTTCAAGTAAGATAATTTAATGG - Intergenic
1046759321 8:118004850-118004872 GGTGAAGTATTTTGATTTACCGG + Intronic
1047198643 8:122744706-122744728 GGTTAAGTATTCAAATTTTATGG - Intergenic
1048069610 8:131007968-131007990 GGCTGACTATGTGAATTTAATGG - Intronic
1048173709 8:132132578-132132600 GGCTAAGGAATTTAATTTAAAGG - Intronic
1048243652 8:132769513-132769535 GCTTCAGTATATTAATTTAGGGG - Intergenic
1048929401 8:139299398-139299420 TTTTAAGTATCTAAATTTAATGG - Intergenic
1050559750 9:6822660-6822682 GGCTGAGTATTTTAATGTAAAGG - Intronic
1050741464 9:8825274-8825296 AGTTAAGTTTGATAACTTAAAGG + Intronic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1060728830 9:126024593-126024615 GCCTAATTATGTTAATTAAACGG + Intergenic
1062506384 9:136879546-136879568 GGAAAAATATGTTAATGTAATGG - Intronic
1187515224 X:19963343-19963365 GTTTAAGAATGTTACCTTAAGGG - Intronic
1188595823 X:31898749-31898771 GATTAATTATGACAATTTAATGG - Intronic
1189538215 X:41958836-41958858 TGTTAACTATGTTACCTTAAAGG + Intergenic
1190483726 X:50903431-50903453 TGTAAATTATGTTCATTTAACGG + Intergenic
1192284932 X:69725515-69725537 GCTTAAGTATGTAAAACTAAAGG - Intronic
1195472127 X:105242797-105242819 GATTTATTATGTAAATTTAAAGG + Intronic
1195493788 X:105505978-105506000 GGTATAGTAGGTTAATTTCAGGG - Intronic
1195589139 X:106603667-106603689 GGTCAAGGGTGTTAATCTAATGG - Intergenic
1195803940 X:108741917-108741939 AGTTAAATATATTATTTTAAAGG + Intergenic
1195927942 X:110045303-110045325 GTTTAAAGAAGTTAATTTAATGG + Intronic
1196212049 X:113006956-113006978 GGTTAAGTCTGTAAATCTCAGGG + Intergenic
1196240176 X:113334665-113334687 GGTTTAGTATTTTATTCTAATGG - Intergenic
1197183987 X:123566028-123566050 GTTTAAGTTTTTTAATTTATAGG - Intergenic
1197889690 X:131256987-131257009 GGGCATGTATGTTAATTTTATGG - Intergenic