ID: 1149025004

View in Genome Browser
Species Human (GRCh38)
Location 17:52017343-52017365
Sequence CAAAATGCTGATAGAAACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 6, 2: 25, 3: 104, 4: 590}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149025002_1149025004 4 Left 1149025002 17:52017316-52017338 CCTAGAGACTTGTTAAGTGGTTG 0: 2
1: 19
2: 196
3: 816
4: 2455
Right 1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG 0: 1
1: 6
2: 25
3: 104
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149025004 Original CRISPR CAAAATGCTGATAGAAACAT TGG Intronic
901416877 1:9122372-9122394 CAAAATGCTGTCAGAATCAGTGG + Intronic
902057218 1:13611282-13611304 AATAATGCTGCTATAAACATGGG - Intronic
902112131 1:14090508-14090530 AAAAAGGCAGAGAGAAACATTGG - Intergenic
903099562 1:21017011-21017033 AATAATGCTGATATGAACATGGG - Intronic
903990818 1:27268124-27268146 CAAAATGATGATGAACACATTGG - Intronic
904777935 1:32923152-32923174 CATAATGCTGCTATAAATATTGG - Intergenic
904928641 1:34068464-34068486 CAACATGCTAATAATAACATGGG - Intronic
905753993 1:40491706-40491728 AAAAAAGATTATAGAAACATTGG - Intronic
905767511 1:40613770-40613792 AATAATGCTGAAATAAACATGGG + Intergenic
906906893 1:49904392-49904414 CAACATGATGACAGAGACATTGG + Intronic
906986464 1:50688390-50688412 AATAATGCTGCTATAAACATGGG - Intronic
907512869 1:54975280-54975302 CATAAGGATGATAGAAACTTTGG + Intergenic
908591592 1:65642676-65642698 AAAAATCCTAATAGAAAAATAGG - Intergenic
908771434 1:67600465-67600487 AATAATGCTGCTATAAACATGGG + Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909491487 1:76231782-76231804 AATAATGCTGCTAAAAACATGGG + Intronic
910309890 1:85811261-85811283 CATAATGCTGCTACGAACATTGG + Intronic
910599826 1:89019163-89019185 AATAATGCTGATAGGATCATGGG - Intronic
910603914 1:89062212-89062234 AATAATGCTAATAGGAACATGGG - Intronic
910636227 1:89411311-89411333 AATAATGCTAATAGGAACATGGG + Intergenic
910834278 1:91492533-91492555 AATAATGCTGCTATAAACATTGG - Intergenic
911477677 1:98393398-98393420 AAAAATGACCATAGAAACATGGG + Intergenic
912080553 1:105931362-105931384 CAAAATGCTAATAGCCAAATGGG + Intergenic
912250532 1:108007797-108007819 CAAAATGTTGAGCAAAACATAGG - Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912548679 1:110469850-110469872 CATAATGCTGCTACAAACATGGG + Intergenic
912578587 1:110699414-110699436 CAAAAACCTGATGGAAAAATGGG + Intergenic
913414228 1:118587740-118587762 CATAATGCTGAAATGAACATGGG + Intergenic
915688398 1:157660914-157660936 CATAATGCTGTGATAAACATGGG + Intergenic
916041638 1:160966477-160966499 GAAAATGCTGCTATGAACATGGG - Intergenic
916223886 1:162470766-162470788 CATAATGCTGCTATTAACATGGG + Intergenic
917653041 1:177097718-177097740 CAAATTGGTGATTGAAACCTTGG + Intronic
917990746 1:180375996-180376018 CAAAAACCTGATAGAAAAATGGG + Intronic
918601474 1:186368135-186368157 CAAAATTTAAATAGAAACATTGG - Intronic
918695116 1:187535819-187535841 AACAATGCTGCTATAAACATGGG + Intergenic
918781446 1:188704850-188704872 CAAAAATCTGATAAAAATATAGG - Intergenic
918874458 1:190021638-190021660 CAAAATGCTGATAGACGCTAAGG - Intergenic
918884441 1:190173077-190173099 CAAAAGTATGATAGAAACAAGGG - Intronic
919140549 1:193565882-193565904 TAAAAAGCTGATAGAAACACAGG - Intergenic
919173902 1:193994773-193994795 AAAAATGCTGCAATAAACATAGG - Intergenic
919221880 1:194640115-194640137 TACAATGCAGATACAAACATTGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919719275 1:200814251-200814273 CAAAATGCTTAAAGATACATGGG + Intronic
920790863 1:209089900-209089922 CAAAATGCTTAAAGAAATAATGG + Intergenic
921802380 1:219416368-219416390 CAAAATCATGAGAAAAACATTGG - Intergenic
922311365 1:224394805-224394827 CTTAATGGTGATTGAAACATAGG + Intronic
923090467 1:230736724-230736746 CAAAGTGCTGCTAGAAGAATTGG - Intergenic
923478456 1:234359526-234359548 CTAAAAGCTAATAAAAACATAGG + Intergenic
923621077 1:235579962-235579984 AATAATGCTGTTAGGAACATGGG - Intronic
924265575 1:242278208-242278230 AAAAATGGTCATAGAAAAATAGG + Intronic
924661213 1:246019084-246019106 CAAAAAGCTCAGAGAAAAATGGG - Intronic
1063455694 10:6181322-6181344 AATAATGCTGATATAAACATGGG - Intronic
1063719822 10:8568744-8568766 CAAAATGATGATTCAAAGATTGG + Intergenic
1065249828 10:23799546-23799568 CAAAATGCTTCTACCAACATGGG + Intronic
1065373486 10:25013484-25013506 CAAAATGCTTATGGAAGCTTAGG + Intronic
1065633434 10:27706323-27706345 AATAATGCTGCTACAAACATGGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066679984 10:37928962-37928984 AATAATGCTGCTAGTAACATTGG + Intergenic
1066719250 10:38320258-38320280 AAAAATGGTCATAGAAAAATAGG - Intergenic
1066806212 10:39257559-39257581 CAAACTGCTGAAAGAAAGAAAGG + Intergenic
1067448256 10:46366330-46366352 CAAATTGCTATTGGAAACATTGG + Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1067877241 10:50017800-50017822 CAAATTGCTATTGGAAACATTGG + Intergenic
1068147910 10:53094694-53094716 CAAAATGTTGACAGCAACAAAGG - Intergenic
1068967074 10:62923462-62923484 AATAGTGCTGATATAAACATGGG - Intergenic
1070984502 10:80677105-80677127 TAAAATGCTGTTAAACACATGGG + Intergenic
1071105066 10:82084645-82084667 CAAAATGTTCACAGAAAAATAGG - Intronic
1072264809 10:93716897-93716919 AATAATGCTTATATAAACATTGG + Intergenic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072312119 10:94166644-94166666 CAAAATGCTGAGTGTAACAGAGG + Intronic
1072597069 10:96883491-96883513 CCAAATGCTGGTGAAAACATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073667334 10:105548304-105548326 CAATATTCTGAAAGAAACTTAGG - Intergenic
1073832795 10:107405610-107405632 CAAAATGTTTATACAAACAGTGG + Intergenic
1074597118 10:114877640-114877662 CAAAATTCTAATTGAGACATTGG + Intronic
1074730609 10:116370028-116370050 CAAAAGCCTGATAGAAAAATGGG - Intronic
1075341277 10:121648531-121648553 CAACATGCAGGTAGAAACTTGGG - Intergenic
1076178347 10:128386078-128386100 AATAATGCTGCTATAAACATGGG - Intergenic
1076786611 10:132752779-132752801 CAAAATGCTGAGAGAAAAGGAGG - Intronic
1077494052 11:2877141-2877163 CCAATTTCTGATAGAATCATAGG + Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078137945 11:8667855-8667877 AATAATGCTGCTAGAAACATGGG + Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079277043 11:19050338-19050360 AATAATGCTGAAATAAACATGGG - Intergenic
1079307958 11:19340902-19340924 CCAAGTGCTGCTAGAAGCATGGG - Intergenic
1079327304 11:19505275-19505297 CAATATGCAGAGAGAAACAGAGG - Intronic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080292490 11:30686692-30686714 CAAAATGCTGGTTGTAACAACGG - Intergenic
1080729080 11:34929893-34929915 TCAAATGCTGATAGTTACATTGG + Intronic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082307019 11:50591523-50591545 CAAACTGCTGAAAGAAAAAGTGG - Intergenic
1082318927 11:50772210-50772232 TAAAAACCAGATAGAAACATTGG - Intergenic
1082708086 11:56518321-56518343 CAAAGTGCTGGTAGAAATAGGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083047274 11:59748364-59748386 AATAATGCTGCTAGGAACATTGG - Intronic
1083206958 11:61157181-61157203 AATAATGCTGCTACAAACATGGG + Intronic
1083692373 11:64417962-64417984 AAGAATGCTGCTAGGAACATGGG - Intergenic
1085563887 11:77495588-77495610 AATAATGCTGCTATAAACATAGG - Intergenic
1085649394 11:78253684-78253706 CAAAGTGATGAGAGAAAGATTGG - Intronic
1085918102 11:80915977-80915999 CAAAATGCTGAAAGAAGGAAAGG - Intergenic
1085978824 11:81695867-81695889 CAAAATGCTGAAAGAAAACCTGG + Intergenic
1086213881 11:84353795-84353817 GAAAATGCTGTTACAAACAGAGG - Intronic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087329823 11:96766813-96766835 TAAAATGCTGAAATAAACATGGG + Intergenic
1087823170 11:102734032-102734054 TTAAGTGCTGATAAAAACATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088826460 11:113498672-113498694 CCAAAACCTGATAGAAATATTGG + Intergenic
1090000813 11:122955957-122955979 CAAAATGGTAATAGGAACAGTGG + Intronic
1090098070 11:123763520-123763542 AATAATGCTGAAATAAACATAGG - Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094243882 12:28263633-28263655 AATAATGCTGCTATAAACATGGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094537005 12:31330281-31330303 CAAAATTCTCAAAGAAAAATCGG + Intergenic
1095067589 12:37798791-37798813 CAAACTGCTGAAAGAAATAAAGG - Intergenic
1095254991 12:40024088-40024110 CAGAATCCTGATAGAGACATAGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097298590 12:57994384-57994406 AAAAATGCTGCTACCAACATGGG + Intergenic
1097447283 12:59687540-59687562 CAAAATCCTGAGAAACACATTGG - Intronic
1097476727 12:60066778-60066800 GAAAAAGCTGATAGAATCACTGG - Intergenic
1097485447 12:60192539-60192561 CAAAATTCTAATAGAAATAGTGG - Intergenic
1097530128 12:60789462-60789484 AATAATGCTGAAATAAACATGGG - Intergenic
1099156601 12:79184245-79184267 TTAAATGCTGAAAAAAACATAGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099510167 12:83525128-83525150 CAAAATGCAAATAGAGAAATTGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100267705 12:92993459-92993481 CAAAATGATGAGAGAACCAATGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1101932720 12:109027836-109027858 AAGAATGCTGCTATAAACATTGG + Intronic
1102814789 12:115856311-115856333 CAACAACCTAATAGAAACATGGG - Intergenic
1103040643 12:117692602-117692624 GAAAATGCTGCTATGAACATAGG - Intronic
1103857058 12:123978849-123978871 CTAAATTCTGATATAAAAATGGG - Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104659351 12:130599065-130599087 AAAAATGGTGATGGAAATATTGG + Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105734519 13:23254236-23254258 CAAAATGCTGTTAGAAATGTGGG + Intronic
1106316025 13:28594541-28594563 TATAATGCTGCTATAAACATGGG - Intergenic
1106978435 13:35249824-35249846 CTATATGTTGATAGAAACTTGGG - Intronic
1107159499 13:37209548-37209570 AAAACTGCTGAGAGAATCATTGG + Intergenic
1107640307 13:42435743-42435765 GATAATGCTGCTATAAACATGGG + Intergenic
1108842030 13:54630073-54630095 AAAAATGCAAATACAAACATAGG - Intergenic
1108909765 13:55532539-55532561 CAAAATACTGATATCACCATGGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109700137 13:66013917-66013939 GAAAATGCTGCAATAAACATGGG - Intergenic
1109756377 13:66766097-66766119 AAAAAAGCTGATAAAAGCATGGG + Intronic
1110086226 13:71384135-71384157 AATAATGCTGAAATAAACATGGG + Intergenic
1110195320 13:72781959-72781981 GAAAATGCCGAGATAAACATTGG + Intronic
1110399433 13:75072649-75072671 CAAAATGTTCATGGGAACATAGG - Intergenic
1110432417 13:75440519-75440541 AAATATGGTGATATAAACATAGG - Intronic
1110787579 13:79549073-79549095 TAAAATTCTGAGTGAAACATGGG - Intronic
1111016518 13:82388390-82388412 GAAAAGGCTGATGGAAGCATGGG + Intergenic
1111206040 13:85012531-85012553 CAAAATAGTGGTAGAAACAGGGG + Intergenic
1111206945 13:85022761-85022783 AATAATGCTGCTATAAACATTGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111707694 13:91771134-91771156 CAAAAATCTGATAGAAAATTAGG + Intronic
1112472854 13:99705144-99705166 AATAATGCTGCTATAAACATGGG - Intronic
1112741096 13:102473328-102473350 AATAATGCTGCTATAAACATGGG - Intergenic
1112843036 13:103603430-103603452 AATAATGCTGCTATAAACATGGG - Intergenic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112873540 13:104005678-104005700 CAAAATGCTGTTAAGATCATGGG - Intergenic
1114275703 14:21142071-21142093 AAAAATGCTGCTATGAACATGGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114392796 14:22328238-22328260 CAGAAGGCTCATAGAATCATTGG - Intergenic
1114702499 14:24693416-24693438 AAAAATACTGAGAGAAGCATTGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1115449922 14:33535857-33535879 ATCAATGCTGATAGAAAAATAGG - Intronic
1115615103 14:35087051-35087073 CAAAATGTTGACATCAACATTGG - Intronic
1115913649 14:38285143-38285165 AAAAATGCTGAAATGAACATAGG - Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116278295 14:42866524-42866546 CAAAATTCTCATAGATACAATGG + Intergenic
1116544475 14:46147046-46147068 CAAAGTGCTGATAGCAAAAATGG - Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117210442 14:53492726-53492748 AATAATGCTGTTATAAACATGGG + Intergenic
1117262639 14:54052007-54052029 CAAAGTGCTGATAGAAAAATGGG - Intergenic
1117633383 14:57717025-57717047 AAAAATGCTGTCAGCAACATGGG - Intronic
1118091897 14:62490562-62490584 AATAATGCTGTTATAAACATGGG + Intergenic
1118098337 14:62565353-62565375 CTAGATGCTGCTACAAACATGGG + Intergenic
1118118803 14:62812366-62812388 CAATATGTTGATAAAGACATAGG + Intronic
1118526173 14:66646496-66646518 CATAATGCTGCTATGAACATGGG - Intronic
1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120461369 14:84801018-84801040 AAAAATGCTGCTATGAACATGGG - Intergenic
1120508066 14:85378113-85378135 TAAAAGGCTGAGAGACACATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121532759 14:94669754-94669776 AAAAATGCTGAAGAAAACATAGG + Intergenic
1122020103 14:98830710-98830732 CAATATTCTGATAGAGACACAGG - Intergenic
1122754133 14:103964373-103964395 CAAAATGTTAATAGAAACTTGGG + Intronic
1122872333 14:104644914-104644936 AAAAAAGCTGCTAGAAACACAGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123157429 14:106241927-106241949 AAAACTGCTGAGAGAGACATGGG + Intergenic
1202901557 14_GL000194v1_random:45323-45345 AATAATGCTGCTATAAACATTGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1125691993 15:41603296-41603318 CTAATTTCTGATAGAAACTTAGG + Intergenic
1125705122 15:41727627-41727649 CAAGAAGATCATAGAAACATAGG + Intronic
1126317938 15:47390743-47390765 CAAGATGCTGAGAGAATCACAGG - Intronic
1126384640 15:48081585-48081607 CAAAACTCTAATAGAAAAATTGG - Intergenic
1126508608 15:49439152-49439174 CAACAGCCTGATAGAAACAGAGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126787395 15:52188599-52188621 CAAAATGCTCATCGAAACATTGG - Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127243065 15:57140102-57140124 AATAATGCTGATATGAACATAGG - Intronic
1128102751 15:65017233-65017255 CAAAATGTTGATAGGAACATGGG + Intronic
1128425562 15:67539111-67539133 AATAATGCTGATATGAACATGGG - Intergenic
1129937443 15:79462639-79462661 CAAAATGGTGAAAGAAAGAGGGG + Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131029234 15:89172564-89172586 AATAATGCTGCTATAAACATGGG + Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1131763932 15:95654855-95654877 CAAAATGGTGATGGCCACATGGG + Intergenic
1133362101 16:5182332-5182354 AATAATGCTGCTATAAACATGGG - Intergenic
1134177412 16:12019010-12019032 TAAAATGCTTATAGAAAACTTGG - Intronic
1134477788 16:14590842-14590864 CAAAATGCTGACGGAACAATGGG + Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137968163 16:52957385-52957407 CGAAATGCTGCTATGAACATGGG - Intergenic
1138052837 16:53799431-53799453 CAAAATGGTGATCAAGACATAGG - Intronic
1138320093 16:56104428-56104450 CAAAAGGCTGATAGTACCAAGGG - Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139398285 16:66658572-66658594 CAAAATCCTGATACCCACATTGG + Intronic
1139619887 16:68130094-68130116 AATAATGCTGAAAGAAACATAGG + Intronic
1139724455 16:68885829-68885851 AATAATGCTGCTATAAACATTGG + Intronic
1139789614 16:69423155-69423177 CTGAATGGTGGTAGAAACATGGG - Intergenic
1139789662 16:69423638-69423660 CTGAATGATGGTAGAAACATAGG + Intergenic
1140117174 16:72052342-72052364 GAAAATGCTGCTATGAACATTGG + Intronic
1143121744 17:4612174-4612196 TAAAATGCTCAAAGAACCATGGG - Intergenic
1143470428 17:7171117-7171139 CAAAATGATGAAAGACACATTGG - Intergenic
1143701186 17:8661378-8661400 GAAGATGATGATAGAAATATAGG - Intergenic
1143973443 17:10812732-10812754 GAAAATGGTGACAGAAATATCGG - Intergenic
1144630261 17:16868083-16868105 AAGAATGCTGCTAGAAACATGGG - Intergenic
1144651106 17:17007701-17007723 AAGAATGCTGCTATAAACATGGG + Intergenic
1145079321 17:19881574-19881596 CAAAATGCTGAGAGCAACTCTGG + Intergenic
1146530045 17:33600810-33600832 CAGAATGTTGGTAGAAATATGGG + Intronic
1146906160 17:36619332-36619354 AATAATGCTGCTAGGAACATGGG + Intergenic
1147248994 17:39141578-39141600 AACAATGCTGCTACAAACATGGG + Intronic
1148247210 17:46041009-46041031 CAAAATACTGATAGAAATACGGG + Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149084889 17:52704127-52704149 CATAATGCTGAAATGAACATGGG + Intergenic
1149129095 17:53274175-53274197 CCAAATGCTCATAGAAAAATCGG + Intergenic
1149342203 17:55698757-55698779 CAACAAGGTGAAAGAAACATGGG - Intergenic
1149523222 17:57334267-57334289 CAAAATGCTGATAAAATCTGAGG + Intronic
1149802071 17:59579134-59579156 CATAGTGCTGATATGAACATTGG + Intronic
1149844419 17:59996355-59996377 CATAGTGCTGATATGAACATTGG - Intergenic
1150557964 17:66270618-66270640 AATAATGCTGCTATAAACATGGG + Intergenic
1150959314 17:69896604-69896626 CAAAGTGCAGATAGAGCCATGGG + Intergenic
1150971788 17:70036334-70036356 TAAAATACTGATATAAACAAAGG + Intergenic
1151841595 17:76622205-76622227 CAAAAACCTAATAGAAAAATAGG - Intergenic
1152009568 17:77703573-77703595 AATAATGCTTCTAGAAACATGGG + Intergenic
1152916919 17:83043786-83043808 CAAAATGCTGAAATAAAAAGTGG + Intronic
1153787926 18:8551443-8551465 AATAATGCTGCTATAAACATGGG - Intergenic
1153856760 18:9156668-9156690 AATAATGCTGCTATAAACATGGG - Intronic
1154958430 18:21282967-21282989 AAAAATGCTCATAGAAAAATAGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156780083 18:40840256-40840278 GAAAATGCAGATAGTAAAATGGG - Intergenic
1156929498 18:42624777-42624799 CTAAATGCTGGGAGAAAAATAGG - Intergenic
1156975866 18:43220957-43220979 CAGAAAGCTGATAGAAATACAGG - Intergenic
1157696151 18:49725399-49725421 AATAATGCTGCTATAAACATTGG + Intergenic
1158096345 18:53776238-53776260 CAAAATCATCATAGAAAAATCGG - Intergenic
1158758329 18:60353298-60353320 CAATCAGCTGATAGAAACAATGG - Intergenic
1158866349 18:61641166-61641188 AAGAATGCTGATATGAACATTGG - Intergenic
1160010266 18:75101965-75101987 TGAAATGTTGATAGAAATATGGG - Intergenic
1161982282 19:7636406-7636428 TAACATGCTGATACACACATGGG - Intronic
1163502356 19:17684132-17684154 CAAAATGCTGTGAGGCACATAGG + Intronic
1164883152 19:31753141-31753163 AATAATGCTGCTCGAAACATGGG - Intergenic
1167735412 19:51291619-51291641 CAAAATGATGACAGAAATCTGGG + Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925306986 2:2855061-2855083 CAAAACACTGACAGTAACATGGG - Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925690107 2:6513138-6513160 TAAACTGCTGTTAAAAACATTGG - Intergenic
925860266 2:8168561-8168583 CAAAAAGCTGATGGAAAGCTAGG + Intergenic
926459165 2:13107431-13107453 AAGATTGCTGATATAAACATTGG - Intergenic
926764195 2:16308525-16308547 CATAATGCTGCTATGAACATGGG + Intergenic
926824915 2:16896381-16896403 TAGAATGATGATAGAGACATGGG - Intergenic
926984050 2:18601853-18601875 AAAAGTGCTGAAAGAAACATGGG - Intergenic
927045003 2:19269097-19269119 CATAGTGCTGAAATAAACATGGG - Intergenic
927714949 2:25345695-25345717 AATAATGCTGCTATAAACATTGG - Intergenic
928302621 2:30139841-30139863 AATAATGCTGCTATAAACATGGG + Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929101629 2:38320422-38320444 CAAAATGTTGACAAATACATTGG + Intronic
929270177 2:39963346-39963368 CAAAAGGCTGATGGCAGCATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929998397 2:46844431-46844453 AATAATGCTGCTATAAACATTGG + Intronic
930277318 2:49327657-49327679 AATAATGCTGTTATAAACATGGG - Intergenic
930405498 2:50950533-50950555 CAAAATGTTAATAGCAACAAAGG - Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
932164850 2:69496775-69496797 CAAGAGGGTGATAGATACATAGG - Intronic
932382195 2:71294823-71294845 CAAATTGCTGAAAGAAATAAAGG - Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933692263 2:85188437-85188459 CAAAATGATTATAGATTCATAGG - Intronic
934505203 2:94885795-94885817 AATAATGCTGCTATAAACATTGG - Intergenic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935521125 2:104106646-104106668 AATAATGCTGCTATAAACATTGG - Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936935070 2:117831879-117831901 CAAAATGATGCTAGCAACTTTGG - Exonic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937497952 2:122444310-122444332 AAAAATGCTGCTATGAACATGGG + Intergenic
937577425 2:123440916-123440938 AACAATGCTGAAATAAACATGGG - Intergenic
937601074 2:123733179-123733201 AATAATGCTGATGTAAACATTGG + Intergenic
937611084 2:123862370-123862392 CAAAGTGCAAATAGAAAAATTGG + Intergenic
937660268 2:124422882-124422904 CAAAATGCTTATACAAGCACTGG - Intronic
938186492 2:129236775-129236797 CAAAATGTTGATAGGAATCTGGG + Intergenic
938768259 2:134478391-134478413 CATAATGCTCATAAAAATATGGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939677511 2:145090686-145090708 CAGAATGTTGATGGAAATATGGG + Intergenic
940026760 2:149216507-149216529 CAAGATGCTGAGTGAAAGATAGG - Intergenic
940270756 2:151887504-151887526 CAAAATGCAGATAGTAACACTGG + Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942109804 2:172669463-172669485 AAAAATGCTGCAATAAACATGGG + Intergenic
942282829 2:174384076-174384098 AATAATGCTGCTATAAACATTGG - Intronic
942703602 2:178741732-178741754 TCAAATGCTGATATAAGCATGGG - Exonic
942888885 2:180963165-180963187 CAAAGTGCTGAAAGAAACCGAGG - Intergenic
943039737 2:182789623-182789645 AATAATGCTGCTATAAACATGGG + Exonic
943213065 2:184993300-184993322 CAACATTCTGATAGATATATTGG + Intergenic
943227620 2:185200116-185200138 CAAAATTATGATAGATATATAGG - Intergenic
943298359 2:186166101-186166123 AATAATGCTGCTATAAACATGGG - Intergenic
943729642 2:191288148-191288170 AATAATGCTGCTATAAACATGGG + Intronic
943899271 2:193411439-193411461 AATAATGCTGAAATAAACATAGG + Intergenic
943972312 2:194426530-194426552 CAACATGCTGATAAAATCAAGGG - Intergenic
944959594 2:204855992-204856014 AATAATGCTGAAATAAACATGGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946468973 2:219938951-219938973 CAGAATGCTCATAGAAACATGGG + Intergenic
946998508 2:225424993-225425015 CATAATCATTATAGAAACATTGG + Intronic
947295926 2:228630131-228630153 CATAATGCTGCAATAAACATGGG - Intergenic
947409856 2:229825599-229825621 CCAAATGCTTATAAAACCATCGG + Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947862292 2:233369225-233369247 CAGAATGCTGATGGATACAGTGG - Intronic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
948090459 2:235289601-235289623 CAAAAGCCTGATAGATAAATGGG + Intergenic
1169050526 20:2573171-2573193 AAAAATGCATGTAGAAACATGGG - Intronic
1169494422 20:6101004-6101026 CAAAATGGCCATAAAAACATTGG + Intronic
1170544370 20:17422051-17422073 CTAAATGATGGTGGAAACATAGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1170927137 20:20735244-20735266 CAAATTTCTAATAGAAAAATGGG + Intergenic
1171197245 20:23209412-23209434 CAGAATGTTGATATAAATATGGG + Intergenic
1171268317 20:23792573-23792595 CAAAAAGCTGATAGAACCCTTGG - Intergenic
1173244234 20:41324111-41324133 AATAATGCTGCTATAAACATGGG - Intergenic
1174040035 20:47692987-47693009 CAAAATGCTGATTGAAGACTGGG + Intronic
1174764635 20:53241246-53241268 CAAAATTCTGGGAGATACATAGG - Intronic
1175060239 20:56235376-56235398 CAATATTCTGATAGAGACGTTGG - Intergenic
1175234079 20:57496888-57496910 AAAAATGCTGCTATGAACATAGG + Intronic
1175347971 20:58296038-58296060 GCAAATGCTGATAGAAACAAGGG + Intergenic
1175618815 20:60425944-60425966 CAAAATGATGCTAGCAACTTTGG + Intergenic
1176620932 21:9060097-9060119 AATAATGCTGCTATAAACATTGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177268770 21:18818987-18819009 AAAACTGATGATAGAAAAATTGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177478071 21:21650425-21650447 CAATATGCTAATAGAAATATGGG + Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177946790 21:27480396-27480418 CTAAATTTTGATAGAAATATGGG - Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178906067 21:36637866-36637888 CAAAATGCTGGTATACACTTTGG - Intergenic
1179043232 21:37823238-37823260 AAAAATGCTGCAATAAACATAGG + Intronic
1179096953 21:38324571-38324593 CTAATTGCTGATAGAAACCCTGG + Intergenic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179357122 21:40670777-40670799 AAAAATGCTGCTATGAACATGGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1180723511 22:17927372-17927394 CACAATGCTGCCATAAACATGGG + Intronic
1180754111 22:18148310-18148332 CAAGATTCAGATAGAATCATTGG + Intergenic
1184269101 22:43368135-43368157 AAAAATTCTAAAAGAAACATAGG - Intergenic
1185082439 22:48717469-48717491 CGAATTCCTGCTAGAAACATTGG - Intronic
950514721 3:13457149-13457171 AATAATGCTGCTATAAACATGGG - Intergenic
950842395 3:15979995-15980017 GAAAATGCTGCTATGAACATGGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
950990403 3:17431687-17431709 AAATATGCTGATAGTTACATTGG + Intronic
951503366 3:23415345-23415367 AAAAATACTGATACAGACATAGG - Intronic
951758221 3:26116443-26116465 GATAATGCTGATATGAACATTGG + Intergenic
951977722 3:28531904-28531926 AATAGTGCTGAAAGAAACATGGG - Intronic
952134112 3:30397946-30397968 CAGAATTCTGATAAAAACACAGG - Intergenic
953724411 3:45385188-45385210 AACAATGCTGCTATAAACATGGG + Intergenic
955495425 3:59526934-59526956 AATAATGCTGCTATAAACATTGG - Intergenic
956404204 3:68911267-68911289 CGAGAAGATGATAGAAACATGGG - Intronic
957384162 3:79473381-79473403 CAACATGCTAATACAACCATAGG - Intronic
957515796 3:81249389-81249411 CCAGATGCTGATAGAAAAACAGG - Intergenic
957602313 3:82353593-82353615 CAAAATGCTATTAAAAACATGGG + Intergenic
957881860 3:86225806-86225828 AAAAATGCTGCTATAAACATGGG - Intergenic
957903964 3:86534174-86534196 CAAAATACTGGTAGAAATATGGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959195572 3:103176225-103176247 AATAATGCTGATATAAACATGGG + Intergenic
959204123 3:103283349-103283371 GAAAAGGCTGATGGCAACATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG + Intergenic
959311860 3:104748579-104748601 CAGAATGTTGGTAGACACATGGG + Intergenic
960352073 3:116606227-116606249 CATACTTCTGATAGAAACAGGGG + Intronic
960635268 3:119779011-119779033 CAAAATTCTAAGAGAGACATTGG + Intergenic
960774852 3:121237942-121237964 CAAAATACTGACAGAAATATGGG - Intronic
960824847 3:121771788-121771810 CAAGATGCTGACTGAAACACAGG + Intronic
962386798 3:134938339-134938361 TAACATGCTGGTAGAAACCTGGG + Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963587650 3:147213389-147213411 AATAATGCTGCAAGAAACATAGG - Intergenic
963742171 3:149091635-149091657 CAAAATGAGGATATGAACATTGG + Intergenic
964039440 3:152241596-152241618 AATAATGCTGCTATAAACATGGG - Intergenic
964156905 3:153596653-153596675 AAAACTTCTGATAGAAACTTTGG + Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964666533 3:159180719-159180741 TAAAAAGTTGAGAGAAACATGGG + Intronic
964858742 3:161176413-161176435 CAAAATGCTACTATAAAAATAGG + Intronic
965082491 3:164052625-164052647 ACTAATGCTGATATAAACATGGG + Intergenic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965717636 3:171624195-171624217 CAAAATCTTAATAGAAAAATGGG + Intronic
965788435 3:172361571-172361593 CAAAGCGCTGATGGAAATATGGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967678607 3:192331857-192331879 CCAAATGCTGAGAAAAATATTGG + Intronic
968397270 4:253084-253106 CAGAGTGCTGAAAGAAACAGTGG - Intergenic
969099698 4:4759699-4759721 CAAAAGACAGACAGAAACATTGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971722330 4:30261677-30261699 TAAAATGCTGATAGAAATTCTGG - Intergenic
971860481 4:32096819-32096841 CAGAATGTTGATAGAAATATGGG - Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
972223527 4:36984515-36984537 AATAATGCTGCTATAAACATAGG - Intergenic
972608781 4:40637984-40638006 AAAAATGTTGGTTGAAACATTGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974151275 4:58012958-58012980 AATAATGCTGCTAGGAACATTGG - Intergenic
974477250 4:62399056-62399078 AAAAAACCTGATAGAAATATGGG - Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975506613 4:75145129-75145151 TAAAATGCTGACAGAAATATGGG - Intergenic
975705466 4:77108139-77108161 GATAATGCTGAAATAAACATGGG - Intergenic
975761712 4:77626635-77626657 AATAATGCTGAAATAAACATGGG + Intergenic
976385898 4:84457945-84457967 CAAAATCCAGAAAGTAACATTGG + Intergenic
976426939 4:84914876-84914898 AAAATTGCTGATAAGAACATTGG - Intronic
976787870 4:88842931-88842953 CAAAATACTGAGAGAAATATCGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977379534 4:96254330-96254352 TAAAATACTGAAAGAAAAATTGG + Intergenic
978057331 4:104287704-104287726 AATAATGCTGAAATAAACATGGG + Intergenic
978475506 4:109124244-109124266 TAAAATGCTGAAAAATACATGGG - Intronic
979319581 4:119307686-119307708 AAAAGTGCTGCTATAAACATGGG - Intergenic
980066675 4:128196737-128196759 AATAATGCTGCTACAAACATGGG - Intronic
981083945 4:140663588-140663610 GAAAATGCTGCAATAAACATAGG - Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981481860 4:145246773-145246795 CAAAATGCTGCTAGGTGCATTGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981559819 4:146034778-146034800 AAAAATTCTAAAAGAAACATTGG + Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982214730 4:153071177-153071199 AATAATGCTGCTATAAACATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983764195 4:171455820-171455842 AAAAATGCTAAAAGAAACAAAGG - Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984129707 4:175858630-175858652 CAAAATGGTAAAAGAAACTTTGG + Intronic
984286388 4:177734897-177734919 GATAATGCTGTTATAAACATGGG + Intronic
984692033 4:182737350-182737372 CAAAATAAGGAAAGAAACATGGG - Intronic
984913984 4:184703711-184703733 AATAATGCTGCTACAAACATTGG - Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
987418789 5:17693479-17693501 AAAGAAGGTGATAGAAACATTGG - Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987480044 5:18441755-18441777 AATAATGCTGCTAGGAACATGGG - Intergenic
987502082 5:18725003-18725025 AAAAATGCTGCTATGAACATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987657447 5:20824203-20824225 AAAAATGCTGATGGCAGCATGGG + Intergenic
987790002 5:22552733-22552755 TAAAATGTTAATAGAAAAATGGG - Intronic
987790036 5:22553209-22553231 CAAAATGATAATTTAAACATTGG + Intronic
987870259 5:23608291-23608313 AAAAGTGCTGAAATAAACATGGG + Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
987974798 5:25000167-25000189 CAAAATTCTCCTAGAAACCTGGG + Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988766097 5:34379743-34379765 AAAAATGCTGATGGCAGCATGGG - Intergenic
988919013 5:35923447-35923469 AATAATGCTGCTATAAACATGGG - Intronic
989265900 5:39473541-39473563 AAAACTGCTGATAGTACCATGGG - Intergenic
989408162 5:41085633-41085655 GACAATGCTGAAAGAAATATTGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989686417 5:44093102-44093124 CTAAATTTTAATAGAAACATTGG + Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990221752 5:53599212-53599234 AAAAATGCTGCTATAAACATTGG + Intronic
990257456 5:53985755-53985777 AATAATGCTGCTACAAACATGGG + Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991144996 5:63290940-63290962 CAAAAATCTGATAGAAAAATGGG - Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992335618 5:75765808-75765830 CATGATGCTGATATAAAAATTGG - Intergenic
992534226 5:77682314-77682336 AAAAATTCTTATATAAACATGGG - Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993124570 5:83817530-83817552 CAAAATGCTTCTGCAAACATAGG + Intergenic
993557826 5:89363773-89363795 CCAAATGTTGATAAGAACATAGG + Intergenic
993599234 5:89900357-89900379 CATAATGCTGCCATAAACATTGG + Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994571369 5:101518149-101518171 TAAATTGATGATAGAAAAATAGG + Intergenic
994850980 5:105054727-105054749 GAAAATGCTGAAATAAACAGTGG - Intergenic
995114527 5:108464564-108464586 AAAAATGAAGATATAAACATTGG + Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995502710 5:112825429-112825451 CAAAATGAGGCTATAAACATGGG - Intronic
995879875 5:116832439-116832461 CTAGATGGTGATATAAACATGGG + Intergenic
996300971 5:121985166-121985188 AAAGATGCTGATAGGCACATTGG + Intronic
996775997 5:127133320-127133342 AAAAATGCTGCTACAGACATGGG + Intergenic
997328085 5:133038556-133038578 AATAATGCTGCTATAAACATTGG + Intergenic
998410387 5:141905798-141905820 AATAATGCTGTTATAAACATGGG - Intergenic
999343236 5:150791695-150791717 AATAATGCTGAAATAAACATGGG + Intronic
999551041 5:152687501-152687523 AATAATGCTGAAATAAACATGGG - Intergenic
1000206574 5:159065974-159065996 CAAAAAGCTCATAGACACTTGGG - Intronic
1000556429 5:162731896-162731918 TAAAATGTTGTTAAAAACATGGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000688316 5:164281553-164281575 CAAAATGGTGCTAGAATAATTGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000911506 5:167028441-167028463 CACACTGCTGGTAAAAACATGGG - Intergenic
1000934925 5:167296012-167296034 CATAATGCTGATAGTACCTTTGG - Intronic
1001050514 5:168410293-168410315 CAAAATGCTTACAGGATCATGGG - Intronic
1002893508 6:1359193-1359215 CAAAAACCTAATAGAAAAATAGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004015199 6:11725953-11725975 AATAATGCTGCTATAAACATGGG - Intronic
1004177918 6:13356537-13356559 CACATTGCTGAAAGAAACTTAGG + Intergenic
1004621770 6:17336929-17336951 CAAAATGTTGATTGACACCTAGG - Intergenic
1004989747 6:21124178-21124200 CAAAATACTTATCTAAACATAGG + Intronic
1005203463 6:23373774-23373796 CAAAATCCAGATATAACCATAGG + Intergenic
1005209676 6:23446170-23446192 CAATCTGCTGGAAGAAACATAGG + Intergenic
1005254233 6:23982865-23982887 CAAAATCCAGAAAGACACATTGG + Intergenic
1005728354 6:28671483-28671505 TAAAATGCAGATAGAAGCCTGGG + Intergenic
1005770715 6:29067948-29067970 CAAAATTCTTAAAGAAAAATTGG + Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1006666346 6:35697131-35697153 AATAATGCTGATATATACATTGG - Intronic
1007143024 6:39595503-39595525 AATAATGCTGCCAGAAACATTGG - Intronic
1007230446 6:40344295-40344317 CAGAATGCTGATTGACATATAGG - Intergenic
1007842231 6:44726145-44726167 AATAATGCTGTTATAAACATGGG - Intergenic
1007989348 6:46239098-46239120 CAGGATGATGATTGAAACATAGG - Intronic
1008253257 6:49266294-49266316 CAAAATCCTGTTAAAAACAAAGG - Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008887072 6:56443107-56443129 AATAATGCTGATATAAACATGGG - Intergenic
1009032656 6:58079044-58079066 TAAAATGCTTATACAAACATAGG + Intergenic
1009063068 6:58420107-58420129 CAAACTGCTGAATGAAACAAAGG + Intergenic
1009208265 6:60830811-60830833 TAAAATGCTTATACAAACATAGG + Intergenic
1009260790 6:61484373-61484395 CAAACTGCTGATTGAAAAAAAGG + Intergenic
1009558550 6:65207793-65207815 AAAAATGGTGATGGAAAAATTGG + Intronic
1009603142 6:65829464-65829486 CAAAATGAAGAAAGTAACATTGG - Intergenic
1009779138 6:68246650-68246672 CAATATGCTAAGAGCAACATAGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010682759 6:78816365-78816387 CAAAATGGTGGTAGAATAATTGG + Intergenic
1010927424 6:81760339-81760361 AAAAATGATGCTAGAAAAATGGG - Intergenic
1011331586 6:86213333-86213355 CAAAATGTTCAGGGAAACATTGG - Intergenic
1011555552 6:88568623-88568645 AATAATGCTGCTATAAACATGGG + Intergenic
1011796383 6:90958135-90958157 CTAAATGCTAGTAGAAATATGGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012148230 6:95713183-95713205 AATAATGCTGCTATAAACATGGG - Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012771209 6:103437243-103437265 CAGAATGCTAATAGAGACATAGG - Intergenic
1013343087 6:109234514-109234536 GATAATGCTGCTATAAACATAGG - Intergenic
1013354997 6:109338936-109338958 TAAAATGGTGATAGAAACTGGGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014720618 6:124913330-124913352 AATAATGCTGCTACAAACATGGG + Intergenic
1014814131 6:125916957-125916979 CAACATGATGAAGGAAACATTGG - Intronic
1015104852 6:129523754-129523776 CAAACTACAGATATAAACATGGG + Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015353589 6:132251378-132251400 CAAAATTCTGACACAAACACAGG - Intergenic
1015461242 6:133494123-133494145 AAAAGTGCTGAAATAAACATAGG - Intronic
1015469671 6:133589823-133589845 AAAAATGCTGCTACAAACATTGG + Intergenic
1015512689 6:134054394-134054416 CAAGAAGCTGCTAGAAACACAGG - Intergenic
1016016060 6:139187441-139187463 CAAAATACTGAATTAAACATGGG - Intergenic
1017424942 6:154310586-154310608 AATAATGCTGAAATAAACATGGG - Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019650599 7:2155745-2155767 AATAATGCTGCTAGGAACATGGG + Intronic
1019863058 7:3678317-3678339 AATAATGCTGCTATAAACATTGG - Intronic
1020598390 7:10241422-10241444 ACAAATGTTGATAGAAAAATAGG - Intergenic
1020902663 7:14025202-14025224 TAAAAAGCTGATAGAAACTGTGG - Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021965040 7:25909295-25909317 CAATATGCTGGTATAAAAATTGG + Intergenic
1022216829 7:28271081-28271103 AATAATGCTGCCAGAAACATGGG - Intergenic
1022657983 7:32338681-32338703 AATAATGCTGCTAGGAACATGGG - Intergenic
1022878633 7:34563158-34563180 AGAAAAACTGATAGAAACATTGG - Intergenic
1023223178 7:37942165-37942187 AAAAATGCTGCTATAAACATAGG - Intronic
1024464175 7:49692840-49692862 AAAAATGGTGATAAAAACACTGG - Intergenic
1024603529 7:51007520-51007542 CTAAATGGTGAGAGAAGCATAGG - Intergenic
1026047889 7:66920464-66920486 CATACTGCTGCTAAAAACATTGG + Intergenic
1026490410 7:70858241-70858263 CAATATGCTGAAAGCAATATGGG - Intergenic
1027789376 7:82620015-82620037 CAGAATGCTGATAGAAATACTGG + Intergenic
1028676226 7:93465055-93465077 CTGAAAGCTGATAGAAATATAGG - Intronic
1029067245 7:97863173-97863195 AATAATGCTGCTATAAACATTGG - Intronic
1030781004 7:113600103-113600125 CAACGTTCTGATAGAAAAATAGG + Intergenic
1031165413 7:118222009-118222031 CAAAAGGCAAATAGAAACAGAGG + Intronic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031611579 7:123833947-123833969 CATAATACTGATATAAAAATAGG - Intronic
1032281626 7:130507656-130507678 CAATATACTGATAGCAAAATGGG + Intronic
1032962302 7:137050491-137050513 AATAATGCTGAAATAAACATGGG - Intergenic
1033107820 7:138545759-138545781 CAAAATGCTCAGAGAATAATGGG + Intronic
1033416368 7:141165106-141165128 CAAAATGCAGAAATTAACATTGG + Intronic
1033470091 7:141639323-141639345 GCAAAAGCTGAGAGAAACATGGG + Intronic
1033975369 7:147094243-147094265 CAGAATGTTGATAGAAATTTGGG - Intronic
1034116057 7:148584898-148584920 CATAATGCTGATTTGAACATGGG + Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035089756 7:156298433-156298455 AATAATGCTGCTATAAACATTGG - Intergenic
1035328026 7:158077406-158077428 CAACAGGCTGAAAGAAACAATGG + Intronic
1036458228 8:8928298-8928320 CATAATGCTGCTATAAACTTTGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039003587 8:33008881-33008903 CAAAAAGGTCATAGACACATCGG + Intergenic
1040662040 8:49584823-49584845 CAAAATACTAAAAGTAACATGGG + Intergenic
1041061694 8:54041034-54041056 TAAAATTTTTATAGAAACATGGG - Intergenic
1041113751 8:54513304-54513326 GAAAATGATGATAGAAACAGAGG + Intergenic
1041485048 8:58366628-58366650 AATAATGCTGCAAGAAACATGGG - Intergenic
1042427497 8:68665224-68665246 CAAAATACAGATGGAAATATTGG + Intronic
1042691994 8:71510194-71510216 CAAAATGATGAGAGACTCATGGG + Intronic
1042726320 8:71881503-71881525 AACAATGCTGCTACAAACATAGG + Intronic
1042731666 8:71942231-71942253 CAAAGTAATGCTAGAAACATTGG - Intronic
1043003904 8:74794478-74794500 GAAAATGTTGATAAAAACTTTGG - Intronic
1043308632 8:78829691-78829713 CAAAAACCTGATATAAAAATGGG + Intergenic
1043390640 8:79788091-79788113 CAAAAAGTTGATAGCAACATGGG + Intergenic
1043535390 8:81198095-81198117 AATAATGCTTATAGAAGCATTGG + Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1043741688 8:83821676-83821698 GACATTGCTGATAGTAACATAGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044163603 8:88952028-88952050 GAAAATGCTGATATATAGATGGG + Intergenic
1044164626 8:88966871-88966893 CAGAATGTTGGTAGAAATATTGG + Intergenic
1044218613 8:89643705-89643727 GAAAGTGCTGGTATAAACATAGG - Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045650134 8:104333990-104334012 CAATATGTTGATAGACACTTGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1045874389 8:106962097-106962119 CAAAATTCAGATGGTAACATAGG - Intergenic
1045998400 8:108390550-108390572 CAAAGTACTGATGGAAATATGGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046188479 8:110756410-110756432 CAAACTGCTGATAGGGACAACGG - Intergenic
1046194012 8:110835255-110835277 CAGAAGGGAGATAGAAACATTGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047416158 8:124666433-124666455 AAAAATACTGATGGAAACACAGG + Intronic
1047664408 8:127074938-127074960 CAAAATGCTAATAGAGGCAGTGG + Intergenic
1048030101 8:130623079-130623101 CAAAATGCTCAAAGAATGATGGG - Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1049908401 9:241665-241687 GAAAATGCTGCAGGAAACATGGG + Intronic
1050107979 9:2185455-2185477 AATAATGCTGCTAGGAACATGGG + Intronic
1050235202 9:3570509-3570531 AATAATGCTGTTATAAACATGGG - Intergenic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051229562 9:14941589-14941611 CAAAAACCTAATAGAAAAATTGG - Intergenic
1051357323 9:16251730-16251752 CATAATGCTGCTATGAACATGGG - Intronic
1051508826 9:17855016-17855038 AATAATGCTGCTATAAACATGGG + Intergenic
1051509057 9:17857548-17857570 CAAAATTCAGAGAGAACCATGGG + Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051656029 9:19382645-19382667 AATAATGCTGATATGAACATGGG + Intergenic
1051809858 9:21036681-21036703 CAATATGTTGATAGTAACCTAGG + Intergenic
1052548181 9:29907857-29907879 CACAATGCTGCAAGGAACATGGG + Intergenic
1052974320 9:34400437-34400459 GGAAATGCAAATAGAAACATGGG + Exonic
1054363642 9:64206429-64206451 CAAACTGCTGATTGAAAAAAAGG + Intergenic
1054762680 9:69017194-69017216 TAAAATGCTGATTTAAAAATTGG + Intergenic
1054833057 9:69647428-69647450 CAAAATGCTGATAAACTCTTAGG - Intronic
1055287678 9:74746664-74746686 GATAATTCTGATAGAAACATAGG + Intronic
1055334097 9:75214543-75214565 CAATATCCTAAAAGAAACATTGG + Intergenic
1055641330 9:78320853-78320875 CTAAAAGCTAATAGAAAAATTGG - Intronic
1055840303 9:80495235-80495257 CAGAATGTTGGTAGAAATATGGG - Intergenic
1056004162 9:82249470-82249492 CAGAATGTTCAGAGAAACATTGG + Intergenic
1056262592 9:84863671-84863693 CAAAATGTTCACAGAAAAATGGG + Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057736898 9:97670946-97670968 AAAAGTGCTGATAGGAACAATGG - Intronic
1058271459 9:102976696-102976718 CATAATGCTGGTAGAAATACAGG - Intergenic
1058433097 9:104936567-104936589 CAAAATGCTGAAAGAGAAAGAGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059007246 9:110417079-110417101 CAAAATACTTATGGAAAAATTGG + Intronic
1059522119 9:114952784-114952806 AAAAATGCTAAGAGCAACATTGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1203744147 Un_GL000218v1:30548-30570 AATAATGCTGCTATAAACATTGG + Intergenic
1203565969 Un_KI270744v1:88965-88987 AATAATGCTGCTATAAACATTGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1185659703 X:1717704-1717726 CAAAGTGCAGACACAAACATCGG - Intergenic
1186323518 X:8454582-8454604 CAAAATGAAGATATTAACATTGG - Intergenic
1187309841 X:18131329-18131351 AATAATGCTGCAAGAAACATGGG - Intergenic
1188146920 X:26625537-26625559 CAAAGTGCACATAGAAAAATAGG - Intergenic
1188661472 X:32764727-32764749 AATAATGCTGCTATAAACATGGG + Intronic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1188810407 X:34647450-34647472 CAACAAGCTGATAGAGACAAAGG + Intronic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189426342 X:40904804-40904826 AATAATGCTGCTATAAACATGGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189730952 X:44020367-44020389 AATAATGCTGTTACAAACATGGG + Intergenic
1190091585 X:47442309-47442331 CAAAAAACTGACAGAAACAAAGG - Intergenic
1190095802 X:47479660-47479682 CACAATGATGATAAAAACAAAGG + Intronic
1190531390 X:51381310-51381332 AATAATGCTGCTATAAACATGGG - Intergenic
1190557536 X:51651184-51651206 AAAAATGCTGCTATGAACATTGG + Intergenic
1190894272 X:54600900-54600922 AATAATGCTGCTACAAACATTGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192522196 X:71812685-71812707 CTAGAACCTGATAGAAACATGGG + Intergenic
1192524047 X:71826229-71826251 CTAGAACCTGATAGAAACATGGG - Intergenic
1193232355 X:79062706-79062728 CACACTGCTGATAAAGACATTGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193422563 X:81300231-81300253 CATAATGCTGCTATGAACATCGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1193670721 X:84382395-84382417 TAAACTGCTGAAACAAACATGGG - Intronic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194499938 X:94669850-94669872 AATAATGCTGAAATAAACATGGG + Intergenic
1194590226 X:95791384-95791406 GAAAATGAAGAAAGAAACATGGG + Intergenic
1194747757 X:97647523-97647545 AAAAATGTTACTAGAAACATAGG - Intergenic
1196023539 X:111015389-111015411 GAATATGCTGCTATAAACATTGG + Intronic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1196309384 X:114144493-114144515 CAAGATACTGAAAGAAAAATTGG - Intergenic
1196945862 X:120825502-120825524 GAAAGTGCTGAGAGAAAAATAGG - Intergenic
1197171374 X:123438404-123438426 AATAATGCTGCTATAAACATTGG + Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1197494893 X:127166674-127166696 CAACATCCTGACAGAAAAATTGG + Intergenic
1197519588 X:127480904-127480926 CACAATGCTGCGACAAACATAGG + Intergenic
1197700906 X:129598846-129598868 AATAATGCTGCTAGGAACATGGG - Intergenic
1197740790 X:129891967-129891989 TAAAATGCTGAAAGAAAGAAAGG + Intergenic
1198026913 X:132715839-132715861 CAAAATGTGGAGAGAAGCATAGG - Intronic
1198213937 X:134539315-134539337 CAAAATGCTACTAAAAAGATAGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199175183 X:144779733-144779755 AATAATGCTGCTATAAACATGGG - Intergenic
1199295323 X:146151103-146151125 CAAAGTGCTTAGAGAAACAAAGG + Intergenic
1199388998 X:147257723-147257745 CAAAATGCTGATAAGAAGTTGGG + Intergenic
1199749338 X:150799926-150799948 CATAATGCTGTTAGGAGCATTGG - Intronic
1199812446 X:151363767-151363789 AATAATGCTGAAACAAACATGGG + Intergenic
1199840513 X:151642787-151642809 TAAAATGTTAATAGAAAAATTGG - Intronic
1200271882 X:154693009-154693031 AATAATGCTGCTATAAACATTGG - Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201157464 Y:11145528-11145550 AATAATGCTGCTATAAACATTGG + Intergenic
1201317307 Y:12660431-12660453 TAAAATGGTGGTAGTAACATCGG + Intergenic
1201748305 Y:17404659-17404681 CAAAATGTGTATAGATACATGGG - Intergenic