ID: 1149036531

View in Genome Browser
Species Human (GRCh38)
Location 17:52140670-52140692
Sequence AGCGTTATGAAATCTGCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149036525_1149036531 27 Left 1149036525 17:52140620-52140642 CCACTGTTTGTCAGCCCCTGCTC 0: 1
1: 0
2: 2
3: 29
4: 316
Right 1149036531 17:52140670-52140692 AGCGTTATGAAATCTGCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 118
1149036528_1149036531 11 Left 1149036528 17:52140636-52140658 CCTGCTCTAGAGTTCCAAAGAGG 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1149036531 17:52140670-52140692 AGCGTTATGAAATCTGCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 118
1149036530_1149036531 -3 Left 1149036530 17:52140650-52140672 CCAAAGAGGCTTTGTTACGCAGC 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1149036531 17:52140670-52140692 AGCGTTATGAAATCTGCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 118
1149036527_1149036531 12 Left 1149036527 17:52140635-52140657 CCCTGCTCTAGAGTTCCAAAGAG 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1149036531 17:52140670-52140692 AGCGTTATGAAATCTGCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 118
1149036526_1149036531 13 Left 1149036526 17:52140634-52140656 CCCCTGCTCTAGAGTTCCAAAGA 0: 1
1: 0
2: 2
3: 31
4: 276
Right 1149036531 17:52140670-52140692 AGCGTTATGAAATCTGCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149036531 Original CRISPR AGCGTTATGAAATCTGCTTT AGG Intronic
903188746 1:21644455-21644477 ACCGTTATGAACCCTGGTTTAGG - Intronic
910269591 1:85379507-85379529 AGCTTTTTGAAATTTGCCTTTGG - Intronic
911988884 1:104665417-104665439 AGCCTTATGAAATTTTGTTTGGG - Intergenic
916736206 1:167608883-167608905 AGCATAATGACATCTGCTTCTGG - Intergenic
917730847 1:177873224-177873246 AGAGTTATGAAATCTGGTTGTGG - Intergenic
917886370 1:179389316-179389338 AGTCTTATAAAATCTGCTATTGG + Intronic
919238334 1:194875956-194875978 AGCTTTATAAAAAATGCTTTTGG + Intergenic
920110972 1:203586749-203586771 AGCATTTGGAAACCTGCTTTTGG + Intergenic
920390845 1:205599792-205599814 AGGGTTATGAAAATTGCTTTGGG - Intronic
920802716 1:209204521-209204543 TGCTTTATAAAGTCTGCTTTGGG - Intergenic
922138747 1:222859662-222859684 AGTCTTTTTAAATCTGCTTTTGG - Intergenic
1065425680 10:25600799-25600821 AGCTTTATAAAATATGCTTTGGG - Exonic
1067785204 10:49240868-49240890 AGCATTAAGAAATTTGCTTAGGG + Intergenic
1068938525 10:62658489-62658511 AGCGTTGTGACACCTTCTTTAGG + Intronic
1078292746 11:10029929-10029951 ATTGTTATGACATCTGCTCTAGG + Intronic
1082217214 11:49585857-49585879 TGGGTTATGAAATCTCATTTTGG + Intergenic
1082792534 11:57356546-57356568 AGCTTCATGAAAGCTGCTGTGGG - Intronic
1082895221 11:58183197-58183219 AGCTTGAAAAAATCTGCTTTTGG + Intergenic
1083212389 11:61196145-61196167 AGGGTTCTGACACCTGCTTTGGG - Intergenic
1086632343 11:89038331-89038353 TGGGTTATGAAATCTCATTTTGG - Intronic
1089652750 11:119925228-119925250 AGCTCTAGGAAATCTGTTTTAGG - Intergenic
1090641997 11:128737735-128737757 AGCCTTAGGAAATGTTCTTTTGG + Intronic
1093912006 12:24759107-24759129 AGTGTGATGAGATTTGCTTTGGG + Intergenic
1094343493 12:29440001-29440023 AACTTTATGAACTCTCCTTTTGG + Intronic
1098760231 12:74414863-74414885 AGAGTTAAGAAAACTGCTTAAGG + Intergenic
1099574350 12:84361970-84361992 AGCGGTTTGCAATCTGCTTCCGG + Intergenic
1099600667 12:84733027-84733049 AGTGTTAAGGAATCTGATTTGGG - Intergenic
1105332432 13:19430353-19430375 AGCGTTATGGAATCTCTTTATGG + Intronic
1105879228 13:24589056-24589078 AGTCTTATAAAATCTGCTTTAGG + Intergenic
1107486914 13:40836865-40836887 AGTCTTATAAAATCTGCTTTAGG - Intergenic
1107624212 13:42266662-42266684 AGCGATATGGAATCTGCTCTTGG + Intergenic
1107686167 13:42901425-42901447 AGGGTTAAGTAATGTGCTTTAGG - Intronic
1108760820 13:53562074-53562096 AGTTTTATGAATTGTGCTTTTGG + Intergenic
1114370737 14:22085035-22085057 AGGGTGATGAAATCTGTTTCTGG - Intergenic
1114624701 14:24121317-24121339 TAGGTTAGGAAATCTGCTTTGGG - Intronic
1121901861 14:97700111-97700133 ATCTTTATGCAATCTTCTTTGGG + Intergenic
1122163229 14:99801796-99801818 AGAGTTAGGAAGACTGCTTTAGG - Intronic
1124411638 15:29442220-29442242 AGCGTTATAAAAACTGGTATGGG + Intronic
1126443588 15:48718182-48718204 AGCTTTTGGAAATCAGCTTTTGG - Intronic
1127061712 15:55193196-55193218 ACCATTCTGAAATCTCCTTTGGG + Intronic
1127183030 15:56444856-56444878 AGGGATAGGAAAGCTGCTTTAGG - Intronic
1127390239 15:58499470-58499492 AGAATTATGAAAGCTGCTTCAGG - Intronic
1132329467 15:101001870-101001892 AGAGCTATGAATTCTGCTGTGGG + Intronic
1143683703 17:8496612-8496634 AGCATTATGAACTCTGCCTACGG - Intronic
1144802485 17:17939889-17939911 AGTGTTAAGAATTCTGCTTTGGG + Intronic
1145097122 17:20039855-20039877 AGCTATAAGAAACCTGCTTTGGG - Intronic
1148565207 17:48628468-48628490 AGCCCTATGAAGTCTGCTGTTGG + Intronic
1149036531 17:52140670-52140692 AGCGTTATGAAATCTGCTTTAGG + Intronic
1151225692 17:72646632-72646654 AGAGTTTTGGAATCTGCTGTGGG - Exonic
1155693550 18:28655934-28655956 AACGTTTTGAAATATGCTCTAGG - Intergenic
1156642786 18:39122438-39122460 AATGTTATGAACTCTCCTTTTGG - Intergenic
1168418670 19:56186155-56186177 AGGTTTATGAAATCGGCTGTGGG + Intergenic
925995064 2:9285521-9285543 ATCATTATGACAACTGCTTTTGG - Intronic
932783195 2:74576510-74576532 AGTGTGATGAAGTCTCCTTTAGG + Exonic
939708808 2:145489193-145489215 TGCGATTTGAAATCTACTTTAGG + Intergenic
941686223 2:168451687-168451709 AGCTTGATAAATTCTGCTTTTGG - Intergenic
941699988 2:168594184-168594206 AGTTTTATAAACTCTGCTTTAGG - Intronic
944794907 2:203173683-203173705 AGAATTATAAAATCTTCTTTTGG - Intronic
944845952 2:203667949-203667971 TGTGTTATCACATCTGCTTTGGG + Intergenic
946592035 2:221260872-221260894 AGAGTTATATATTCTGCTTTAGG - Intergenic
946841346 2:223823250-223823272 AGGGATATGAAATCAGCATTTGG + Intronic
947346568 2:229197247-229197269 AGGGTTATGAACTTTGATTTGGG - Intronic
947674737 2:231968045-231968067 AGGGGTATGAAAACAGCTTTGGG - Intronic
1171077599 20:22144571-22144593 AGAGTTTTGACATCTGCTTTAGG - Intergenic
1172065711 20:32218772-32218794 AGCTTTTTGGAATTTGCTTTTGG - Intronic
1176740588 21:10598187-10598209 AGCGTTATGGAATCTCTTTATGG - Intronic
1181184831 22:21095543-21095565 ACCATTAGGAAATCTGCTGTGGG - Intergenic
949973989 3:9437481-9437503 AGCATAATCAAATCTCCTTTTGG - Intronic
950878746 3:16304098-16304120 ATTGTTAGGAAAACTGCTTTAGG + Exonic
952710575 3:36428067-36428089 AGCATTAAAAAATCTGCTTCAGG - Intronic
953839038 3:46373838-46373860 AGCGTTTGGCAATGTGCTTTTGG - Exonic
957820108 3:85361690-85361712 AGCGTCCTGAAATCTGCTTCTGG + Intronic
960446169 3:117751497-117751519 AGCTGTAGGAAATCTGTTTTGGG - Intergenic
962969546 3:140386101-140386123 AGCATTATGCAAAGTGCTTTAGG + Intronic
964188311 3:153973955-153973977 GGTGACATGAAATCTGCTTTTGG - Intergenic
967386302 3:188914626-188914648 AGCTCTAGGACATCTGCTTTAGG - Intergenic
968278885 3:197460385-197460407 ACCTTCATGAGATCTGCTTTTGG - Intergenic
972762775 4:42123127-42123149 AGCATTCTGAATTGTGCTTTGGG - Intronic
972814289 4:42627158-42627180 CTAGTTATGAAATCTGTTTTTGG - Intronic
974771822 4:66424054-66424076 AGTGTTATGAAATAAGTTTTTGG - Intergenic
976339665 4:83933048-83933070 AGTTTTAGGAAAGCTGCTTTAGG + Intergenic
978768585 4:112430604-112430626 AGCTTTGTCAAAGCTGCTTTCGG + Exonic
984737621 4:183125247-183125269 GGTATCATGAAATCTGCTTTTGG + Intronic
985427379 4:189844032-189844054 AGCCTTATGCAGTTTGCTTTAGG + Intergenic
987632461 5:20493046-20493068 AACTTTATGAAATATGTTTTTGG + Intronic
987819123 5:22939203-22939225 GGCTTTTTGAAAGCTGCTTTTGG + Intergenic
988809300 5:34768603-34768625 GGCATTATGAAATCTCCATTAGG - Intronic
989785859 5:45328634-45328656 AGTGGGATGAAATCTCCTTTGGG - Intronic
990087956 5:52002265-52002287 AATATTATGAAATCTGTTTTAGG + Intergenic
993290223 5:86058735-86058757 AGTGTTATGAAATAATCTTTAGG - Intergenic
997615595 5:135244125-135244147 AGGGTTATGCTATCTGCTTACGG - Intronic
998049250 5:139017727-139017749 AGCCTTCTGTAATCTGGTTTTGG - Intronic
998944174 5:147319463-147319485 AGACTTTTGAAATCTGCCTTTGG + Intronic
1005491956 6:26355331-26355353 AGGCTTATGAAAGCTGCCTTGGG + Intergenic
1008648607 6:53541859-53541881 AGTGTTATCAAATCTTTTTTTGG + Intronic
1016080924 6:139854813-139854835 AGGGTTGTGAAATCTGGATTGGG + Intergenic
1017030339 6:150215413-150215435 ATCATTTTTAAATCTGCTTTTGG + Intronic
1020291363 7:6724936-6724958 AGCATGGTGAAATATGCTTTGGG + Intergenic
1020371306 7:7434895-7434917 AGTATTTTGAAATCAGCTTTAGG + Intronic
1021459092 7:20865628-20865650 AGGTTTAAGAAATCAGCTTTTGG - Intergenic
1028109885 7:86927309-86927331 AGCATAATGAAATGTGCTGTTGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028733469 7:94179707-94179729 ACTGTTATGAAATTGGCTTTGGG - Intergenic
1031511179 7:122651739-122651761 AGATTAATGAAAGCTGCTTTTGG + Intronic
1035760854 8:2067925-2067947 AGGGTTGTAGAATCTGCTTTTGG + Intronic
1035869193 8:3118827-3118849 AGCATTATAAAATTTACTTTTGG - Intronic
1036006393 8:4669101-4669123 AGCTTTAAAAAATCTGCATTTGG + Intronic
1037224464 8:16568277-16568299 AGCTTGATGAAATCTCATTTGGG - Intergenic
1037471377 8:19214986-19215008 AGCTTTGTAAAATCTGCTTCTGG - Intergenic
1041329913 8:56713756-56713778 AGCAATATGAAATCTGCTGGAGG - Intergenic
1041631134 8:60088470-60088492 AGTGTTAGTATATCTGCTTTAGG - Intergenic
1043702769 8:83312319-83312341 AGAGCTATGAAATCCTCTTTGGG - Intergenic
1043959101 8:86395021-86395043 AGCATCATTAAATCTGCTATTGG - Intronic
1044210697 8:89546583-89546605 ACCCTTTTGAAATCTCCTTTTGG + Intergenic
1044930730 8:97249274-97249296 AACGTTAAGAAATGAGCTTTGGG + Intergenic
1045157129 8:99489313-99489335 AGCGTGATGCCATCTCCTTTGGG + Intronic
1046638036 8:116694765-116694787 AGTGTTAAGAAAACTTCTTTTGG - Intronic
1048159281 8:131998122-131998144 ACCATTGTGGAATCTGCTTTTGG + Intronic
1051907062 9:22107381-22107403 AGGCTTAGGAAATATGCTTTAGG - Intergenic
1058226870 9:102375633-102375655 AGAATTATGAAATCAGTTTTCGG + Intergenic
1058555505 9:106162441-106162463 AGAGTTCTGGAATCTTCTTTTGG + Intergenic
1186827323 X:13353359-13353381 ACCGTGAGGAAAACTGCTTTAGG - Intergenic
1187993637 X:24902396-24902418 AGTGTTATGAAAACAGCCTTAGG + Intronic
1189167002 X:38870286-38870308 TCCTTTCTGAAATCTGCTTTGGG - Intergenic
1193180919 X:78455693-78455715 AACTTTATGAAATATGCTTTGGG - Intergenic
1194591548 X:95805676-95805698 AGCGCTCTTAAATCTGCTTGTGG - Intergenic
1199187910 X:144938793-144938815 AGGGTTATGACACCTTCTTTAGG - Intergenic
1199508844 X:148597021-148597043 AGGGTTATGACATCTGCTGGGGG + Intronic
1202598841 Y:26571675-26571697 CACCTTATAAAATCTGCTTTAGG + Intergenic