ID: 1149038067

View in Genome Browser
Species Human (GRCh38)
Location 17:52157493-52157515
Sequence GTGCAGTCCTAGAAGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149038067_1149038080 29 Left 1149038067 17:52157493-52157515 CCTTCACCCTTCTAGGACTGCAC 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1149038080 17:52157545-52157567 CACACACATTCACACACCCTTGG 0: 1
1: 2
2: 64
3: 572
4: 3998
1149038067_1149038081 30 Left 1149038067 17:52157493-52157515 CCTTCACCCTTCTAGGACTGCAC 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1149038081 17:52157546-52157568 ACACACATTCACACACCCTTGGG 0: 1
1: 1
2: 17
3: 323
4: 1471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149038067 Original CRISPR GTGCAGTCCTAGAAGGGTGA AGG (reversed) Intronic
902691991 1:18115722-18115744 GGACTGTCCTAGATGGGTGATGG + Intronic
902966754 1:20010563-20010585 GAGCAGTGCTTGAAGGGTGTAGG + Intergenic
904047412 1:27616850-27616872 GTGCAGCACTACATGGGTGAGGG - Exonic
906457061 1:46006174-46006196 GAGCAGTCCAAGAATGGGGAAGG - Intronic
909364828 1:74807291-74807313 TTGCAGAGCTAGAAGGGTGGTGG - Intergenic
918147909 1:181774089-181774111 ATTCTGTCCTTGAAGGGTGATGG + Intronic
918458951 1:184755665-184755687 GCGCAGTACTACAAGGATGAAGG + Intergenic
920556081 1:206905574-206905596 GTGCATTCCAGGAAGGGGGATGG + Intronic
920658730 1:207897403-207897425 GTGCAATCCAAGAAGGTTTAAGG + Intronic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
1064530903 10:16308652-16308674 GTGCATTCCTAGAATGGCAAGGG + Intergenic
1069274180 10:66568630-66568652 CTGCAGTCCAAGAAGGGTAAGGG + Intronic
1069959453 10:72071042-72071064 TTGCAGTCTTAGAAGGCTGCAGG - Intronic
1069983430 10:72268069-72268091 GTGCAGTCCTGGAAGAGGCAGGG + Intergenic
1070460119 10:76658060-76658082 GGGCACTCCTAGATGGGGGAGGG + Intergenic
1070711992 10:78689592-78689614 GTGCAGTCCCAGGAGGCTGTGGG + Intergenic
1071025367 10:81106906-81106928 GTGGACTGCTAGAAGGGGGAGGG + Intergenic
1074156637 10:110805739-110805761 ATGCAGTCCTAGAAAAGTGCTGG - Intronic
1075358727 10:121809826-121809848 GTGCAGTCAGAGAATCGTGAGGG + Intronic
1076513268 10:131027275-131027297 GTGCAGTCCTGAAAGGTGGAGGG - Intergenic
1077094903 11:795162-795184 CTTCTGTCCTAGAAGGATGAGGG + Exonic
1078410164 11:11108060-11108082 GTGCTGTCATGGAAGGGAGAAGG + Intergenic
1079139303 11:17797102-17797124 GGGCAGCCCTTGAGGGGTGATGG - Intronic
1080012536 11:27472763-27472785 GTGCAACCCTAGAAGGGAAAAGG - Intronic
1082278377 11:50245639-50245661 GTTCAGTCCTAAAAGGGTCTAGG + Intergenic
1082281784 11:50278573-50278595 GTACAGTCCTTGAAGGAAGAGGG - Intergenic
1082651568 11:55800320-55800342 CTGCAGCCCTTGCAGGGTGAAGG + Intergenic
1083596206 11:63919252-63919274 GTGCAGGGTTAGAAGGGGGAGGG + Intergenic
1083809520 11:65095982-65096004 CTGCTGTCCCAGAAGGGGGACGG - Intronic
1084088996 11:66867998-66868020 GTAGAGACCTTGAAGGGTGAGGG + Intronic
1084341000 11:68500907-68500929 GTTCAATACTTGAAGGGTGAGGG + Intronic
1088261257 11:107945960-107945982 GTGTATTGCTTGAAGGGTGAAGG - Intronic
1091098623 11:132848306-132848328 CTACAATCCTAGAAAGGTGATGG + Intronic
1091272453 11:134327177-134327199 GTGCAGACCGAGAAAGGGGATGG - Intergenic
1095683479 12:45005424-45005446 ATGCAGTCATAGATGGGTGAAGG - Intergenic
1100006121 12:89897680-89897702 GTGGAATCCTAGGAGGGTGGAGG + Intergenic
1101532071 12:105582355-105582377 GTTCACTCCTAGAAGCCTGAGGG - Intergenic
1103057125 12:117830341-117830363 GGGGACTCCTAGAAGGGGGAGGG + Intronic
1105972748 13:25445791-25445813 GCGAAGACCAAGAAGGGTGATGG + Intronic
1106103699 13:26716222-26716244 TTGCAGTCCTAGCTGTGTGAGGG + Intergenic
1107757249 13:43637831-43637853 GTGAAATCCTGGCAGGGTGAAGG - Intronic
1115431981 14:33329672-33329694 ACCCTGTCCTAGAAGGGTGAAGG - Intronic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1118795231 14:69137579-69137601 GTGCATTCCTAGAAGTGTTAGGG - Intronic
1119817081 14:77579332-77579354 GTGGAGACTTGGAAGGGTGAGGG - Intronic
1126598476 15:50405165-50405187 GTGGAGTCCTTGAAGGAGGAAGG - Intergenic
1130612470 15:85373831-85373853 TTCCAGTGGTAGAAGGGTGAGGG - Intergenic
1137672540 16:50287733-50287755 GTGCAGTCCTAGAAGACACAGGG + Intronic
1141358818 16:83375596-83375618 GTTAAGTCCTAGAAGAGAGATGG + Intronic
1143178252 17:4968695-4968717 GTGCAGTCTTAACAGGGAGAGGG - Exonic
1143497016 17:7318202-7318224 GAGCTGGGCTAGAAGGGTGAGGG + Intronic
1143521025 17:7444488-7444510 GGTCAGGCCAAGAAGGGTGAAGG + Exonic
1145959594 17:28879709-28879731 GTGCAGCCCTAGCAGGAAGAAGG + Exonic
1146677576 17:34784091-34784113 GTGCGGTCTTAGAAAGATGAAGG - Intergenic
1147647531 17:42042842-42042864 CTACAGTCCCAGGAGGGTGAGGG - Intronic
1148847767 17:50539190-50539212 GTGAGGTCCTGGCAGGGTGATGG + Exonic
1149038067 17:52157493-52157515 GTGCAGTCCTAGAAGGGTGAAGG - Intronic
1151389262 17:73774773-73774795 GTCAAGTCATAGAAGGGTCATGG + Intergenic
1151576862 17:74956845-74956867 GTGCAGTCCTTGCTGGGTGGGGG + Intronic
1158703492 18:59770467-59770489 CTGTAGTCCTTGAAGGGAGAAGG + Intergenic
1158997882 18:62941964-62941986 GTGTATTCATAGAAAGGTGAAGG + Intronic
1160437665 18:78863595-78863617 GTTCACTCCTTGCAGGGTGAGGG - Intergenic
1161085341 19:2332636-2332658 CTGCAGCCCCAGAAGGCTGAGGG + Intronic
1161313958 19:3609244-3609266 CTGCTGGCCGAGAAGGGTGACGG - Intergenic
1162964251 19:14148579-14148601 GTGCAGTCCGGGAAGGGCCATGG + Exonic
1163115102 19:15184530-15184552 CTGCAGGCCGAGATGGGTGAAGG + Intronic
1165945274 19:39437958-39437980 GTCCAGCTCTAAAAGGGTGAGGG + Intronic
1167236479 19:48318938-48318960 GTGCATTCCTAGAGGGGTGTTGG - Intronic
926763580 2:16302705-16302727 GTGTAGCCCCAGAAGGCTGATGG - Intergenic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933349856 2:81139416-81139438 GTGGAGACTTAGAATGGTGAGGG + Intergenic
938924650 2:136028133-136028155 CTGCAGTACTAGGAGGGTGTGGG + Intergenic
943735506 2:191349229-191349251 GTGCAGACCTAAAAGGGTAGAGG + Intronic
943930400 2:193843823-193843845 GTGCAGTCCTAGATTGGTATAGG + Intergenic
944596227 2:201263956-201263978 GTGCAGTGTGAGAAGGCTGATGG - Intronic
947118410 2:226795451-226795473 GTGCAGACCCACAAGGGTGCCGG - Exonic
1170320834 20:15096083-15096105 GTGCAGTAGTAGAACCGTGAAGG + Intronic
1173036007 20:39411192-39411214 ATGAAGTCCTAGAAGGTTAATGG + Intergenic
1175943116 20:62546990-62547012 GTGCATCCCTAGGAGGGGGACGG - Intergenic
1177164023 21:17579729-17579751 AAGCAGTCCTTGAATGGTGATGG + Intronic
1177350442 21:19932600-19932622 GTGTATTTATAGAAGGGTGAGGG + Intergenic
1181320871 22:22005067-22005089 GTCCAGTCCTAGGAGGAGGAAGG - Intergenic
1181891422 22:26066928-26066950 GAGCAGTCCTTGAAGGGGAAGGG + Intergenic
1184799897 22:46752964-46752986 GGGCAGGGCTAGAGGGGTGAGGG - Intergenic
949819366 3:8099564-8099586 GGGAAGGCCCAGAAGGGTGATGG - Intergenic
950094494 3:10321012-10321034 GAGGAGGCCTAGCAGGGTGAAGG - Intronic
951758961 3:26124185-26124207 GTGGACTACTAGAAGGGGGAGGG + Intergenic
952274200 3:31861251-31861273 TTGCTGTCTTAGAAGGGTCATGG - Intronic
953606674 3:44417127-44417149 GTGCAGTTCTGAAAGTGTGAAGG - Intergenic
956122142 3:65977277-65977299 GTGGAGTCCTCGTAGGTTGAGGG - Intronic
957427895 3:80063887-80063909 GTTCTGTCCTAGAAGGATTATGG - Intergenic
957481023 3:80793961-80793983 GTGGAGACTTGGAAGGGTGAGGG + Intergenic
961457637 3:127032063-127032085 ATGCAGGCCTAGGAGGGTGGTGG + Intronic
961564010 3:127750406-127750428 GTGCAGCCTTTGAAGCGTGACGG - Intronic
963525986 3:146413991-146414013 GTGAAGTCCAAGAAGGTGGAAGG + Intronic
964670639 3:159221437-159221459 CTGCAGTCCTAGAATTCTGAAGG + Intronic
966279083 3:178208499-178208521 GTGCTTGCCTATAAGGGTGAAGG - Intergenic
966991545 3:185236366-185236388 GTGCAGGCCTGGGAGGGTGGGGG - Intronic
975711250 4:77162094-77162116 GTTCAGTCCTACAGGTGTGATGG - Intronic
982356316 4:154473563-154473585 ATACAGCCCTAGAAGGGTTATGG + Intronic
985060068 4:186069097-186069119 GTGCATTCCAAGAAGGGCAAAGG - Intergenic
985931454 5:3060907-3060929 GTGAAATCCTAGAAGTGAGATGG - Intergenic
987615573 5:20269705-20269727 TTGTAGACTTAGAAGGGTGAAGG + Intronic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
991119099 5:62990372-62990394 GTGGACTACTAGAAGGGGGAGGG + Intergenic
993679244 5:90854763-90854785 GTGCTGGCCTAGAAGGGTCTAGG + Intronic
996444985 5:123537412-123537434 GTGGAGACTTGGAAGGGTGAGGG + Intronic
998582397 5:143391775-143391797 GTGCAATCCCTGAAGGGTCATGG - Intronic
1000331786 5:160211577-160211599 GTGCAGTACTATAAGGATGAAGG + Intronic
1002372648 5:178767479-178767501 TTGCAGACCTAGCAGGGAGAGGG - Intergenic
1003274863 6:4641019-4641041 GTGCAGTCCAAGAAGATTTATGG + Intergenic
1003401414 6:5794223-5794245 GTGCAGTCCTAGGCAAGTGAAGG + Intergenic
1004332879 6:14737511-14737533 GGGCAGTCCCACAAGGGGGAGGG + Intergenic
1004981848 6:21033003-21033025 GTGCAGTCCAAGTGAGGTGAGGG + Intronic
1006788857 6:36685817-36685839 CTGCAGTCCTGGAAGCGCGAGGG + Exonic
1006789633 6:36691288-36691310 CTGCAGGCCTAGAAGGCTCAAGG + Intergenic
1009614188 6:65984096-65984118 GTGTAGTCCTAGTAGAATGAGGG + Intergenic
1014877973 6:126684726-126684748 GTGGACTACTAGAAGGGGGAGGG + Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019802656 7:3099707-3099729 GAGCAGTCATTGAAGGGTGCCGG + Intergenic
1025093272 7:56080145-56080167 GTTCAGTCCTAAAAGGGTCTGGG + Exonic
1026623503 7:71972191-71972213 GTGGACCCCTAGAAGGCTGAAGG - Intronic
1028112178 7:86954136-86954158 AAGCAGTCCTAGGAGGGAGAAGG - Intronic
1029363465 7:100102754-100102776 GAGCAGTTCTAGGAGGCTGAAGG - Exonic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031581919 7:123486728-123486750 GTGTAGTCCTAGGAGAGTAAAGG - Intronic
1035231496 7:157468611-157468633 GTGCTGTCCCCGAAGGGTGTCGG - Intergenic
1037736825 8:21573911-21573933 GTGCAGTCCTCACAGGGTAAGGG - Intergenic
1039038287 8:33383209-33383231 GTGCAGTCCTAGAGGGTTGGAGG - Intronic
1039713279 8:40080973-40080995 GTGCTGTCTTAGAAGGAAGAGGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1042524777 8:69752904-69752926 GAGGAGTCCTTGAATGGTGATGG - Intronic
1042851531 8:73221259-73221281 GTTCAGTCTTAGGAGGGTGTAGG + Intergenic
1042979694 8:74511839-74511861 CTGCAGTCCTAGAAGATGGATGG + Intergenic
1045342592 8:101267911-101267933 ATGCAGTCCTAGAGGGATGCAGG - Intergenic
1049689845 8:143953642-143953664 GTGCAGTCCACGCAGGGTGGCGG - Intronic
1051476618 9:17515921-17515943 ATGCAGGCCTTGAAGGCTGAAGG - Intergenic
1054880347 9:70138061-70138083 GTGGAGACTTAGAAGGGTGAGGG - Intronic
1060268843 9:122127429-122127451 GAGCCGTCCTAGAGGGGTGGGGG - Intergenic
1061482940 9:130906111-130906133 GAGCCGGCCTAGAGGGGTGAGGG - Intronic
1194342941 X:92728208-92728230 GAGCAGTCTTAGAAGGTTTAAGG - Intergenic
1196642667 X:118081099-118081121 GTGGACTACTAGAGGGGTGAGGG + Intronic
1196737160 X:118989994-118990016 CTGCATTCCTAGAATGGGGATGG - Intronic
1200091221 X:153637024-153637046 GTGCAGTGGTGGAAGGGAGATGG + Intergenic
1200214054 X:154359639-154359661 GTGCAGTCCTGGAGGAGTGCAGG + Exonic
1200651302 Y:5844874-5844896 GAGCAGTCTTAGAAGGTTTAAGG - Intergenic
1201288768 Y:12401893-12401915 GGGCACTCCTAGAAGGGGGAGGG - Intergenic
1201589093 Y:15593836-15593858 GTGCTGTGCTAAAAGAGTGAGGG - Intergenic