ID: 1149046294

View in Genome Browser
Species Human (GRCh38)
Location 17:52249651-52249673
Sequence ACAGTCTGGTGCTGATGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149046294_1149046302 14 Left 1149046294 17:52249651-52249673 CCTGTACATCAGCACCAGACTGT No data
Right 1149046302 17:52249688-52249710 AGGCATGGAGCAGGGACTAGGGG No data
1149046294_1149046306 27 Left 1149046294 17:52249651-52249673 CCTGTACATCAGCACCAGACTGT No data
Right 1149046306 17:52249701-52249723 GGACTAGGGGTGGCTATCAGGGG No data
1149046294_1149046299 6 Left 1149046294 17:52249651-52249673 CCTGTACATCAGCACCAGACTGT No data
Right 1149046299 17:52249680-52249702 CTGTAGACAGGCATGGAGCAGGG No data
1149046294_1149046305 26 Left 1149046294 17:52249651-52249673 CCTGTACATCAGCACCAGACTGT No data
Right 1149046305 17:52249700-52249722 GGGACTAGGGGTGGCTATCAGGG No data
1149046294_1149046297 -1 Left 1149046294 17:52249651-52249673 CCTGTACATCAGCACCAGACTGT No data
Right 1149046297 17:52249673-52249695 TCTTTTACTGTAGACAGGCATGG No data
1149046294_1149046298 5 Left 1149046294 17:52249651-52249673 CCTGTACATCAGCACCAGACTGT No data
Right 1149046298 17:52249679-52249701 ACTGTAGACAGGCATGGAGCAGG No data
1149046294_1149046303 17 Left 1149046294 17:52249651-52249673 CCTGTACATCAGCACCAGACTGT No data
Right 1149046303 17:52249691-52249713 CATGGAGCAGGGACTAGGGGTGG No data
1149046294_1149046296 -6 Left 1149046294 17:52249651-52249673 CCTGTACATCAGCACCAGACTGT No data
Right 1149046296 17:52249668-52249690 GACTGTCTTTTACTGTAGACAGG No data
1149046294_1149046300 12 Left 1149046294 17:52249651-52249673 CCTGTACATCAGCACCAGACTGT No data
Right 1149046300 17:52249686-52249708 ACAGGCATGGAGCAGGGACTAGG No data
1149046294_1149046301 13 Left 1149046294 17:52249651-52249673 CCTGTACATCAGCACCAGACTGT No data
Right 1149046301 17:52249687-52249709 CAGGCATGGAGCAGGGACTAGGG No data
1149046294_1149046304 25 Left 1149046294 17:52249651-52249673 CCTGTACATCAGCACCAGACTGT No data
Right 1149046304 17:52249699-52249721 AGGGACTAGGGGTGGCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149046294 Original CRISPR ACAGTCTGGTGCTGATGTAC AGG (reversed) Intergenic
No off target data available for this crispr