ID: 1149046295

View in Genome Browser
Species Human (GRCh38)
Location 17:52249665-52249687
Sequence GTCTACAGTAAAAGACAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149046295_1149046305 12 Left 1149046295 17:52249665-52249687 CCAGACTGTCTTTTACTGTAGAC No data
Right 1149046305 17:52249700-52249722 GGGACTAGGGGTGGCTATCAGGG No data
1149046295_1149046304 11 Left 1149046295 17:52249665-52249687 CCAGACTGTCTTTTACTGTAGAC No data
Right 1149046304 17:52249699-52249721 AGGGACTAGGGGTGGCTATCAGG No data
1149046295_1149046299 -8 Left 1149046295 17:52249665-52249687 CCAGACTGTCTTTTACTGTAGAC No data
Right 1149046299 17:52249680-52249702 CTGTAGACAGGCATGGAGCAGGG No data
1149046295_1149046306 13 Left 1149046295 17:52249665-52249687 CCAGACTGTCTTTTACTGTAGAC No data
Right 1149046306 17:52249701-52249723 GGACTAGGGGTGGCTATCAGGGG No data
1149046295_1149046302 0 Left 1149046295 17:52249665-52249687 CCAGACTGTCTTTTACTGTAGAC No data
Right 1149046302 17:52249688-52249710 AGGCATGGAGCAGGGACTAGGGG No data
1149046295_1149046300 -2 Left 1149046295 17:52249665-52249687 CCAGACTGTCTTTTACTGTAGAC No data
Right 1149046300 17:52249686-52249708 ACAGGCATGGAGCAGGGACTAGG No data
1149046295_1149046301 -1 Left 1149046295 17:52249665-52249687 CCAGACTGTCTTTTACTGTAGAC No data
Right 1149046301 17:52249687-52249709 CAGGCATGGAGCAGGGACTAGGG No data
1149046295_1149046298 -9 Left 1149046295 17:52249665-52249687 CCAGACTGTCTTTTACTGTAGAC No data
Right 1149046298 17:52249679-52249701 ACTGTAGACAGGCATGGAGCAGG No data
1149046295_1149046303 3 Left 1149046295 17:52249665-52249687 CCAGACTGTCTTTTACTGTAGAC No data
Right 1149046303 17:52249691-52249713 CATGGAGCAGGGACTAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149046295 Original CRISPR GTCTACAGTAAAAGACAGTC TGG (reversed) Intergenic
No off target data available for this crispr