ID: 1149046299

View in Genome Browser
Species Human (GRCh38)
Location 17:52249680-52249702
Sequence CTGTAGACAGGCATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149046294_1149046299 6 Left 1149046294 17:52249651-52249673 CCTGTACATCAGCACCAGACTGT No data
Right 1149046299 17:52249680-52249702 CTGTAGACAGGCATGGAGCAGGG No data
1149046295_1149046299 -8 Left 1149046295 17:52249665-52249687 CCAGACTGTCTTTTACTGTAGAC No data
Right 1149046299 17:52249680-52249702 CTGTAGACAGGCATGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149046299 Original CRISPR CTGTAGACAGGCATGGAGCA GGG Intergenic
No off target data available for this crispr