ID: 1149046318

View in Genome Browser
Species Human (GRCh38)
Location 17:52249788-52249810
Sequence CGTCTGCCCAGGAGACCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149046318_1149046320 16 Left 1149046318 17:52249788-52249810 CCTGAAGGTCTCCTGGGCAGACG No data
Right 1149046320 17:52249827-52249849 AACTTCTCTCTTGCTTTTCTAGG No data
1149046318_1149046321 22 Left 1149046318 17:52249788-52249810 CCTGAAGGTCTCCTGGGCAGACG No data
Right 1149046321 17:52249833-52249855 TCTCTTGCTTTTCTAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149046318 Original CRISPR CGTCTGCCCAGGAGACCTTC AGG (reversed) Intergenic
No off target data available for this crispr