ID: 1149048082

View in Genome Browser
Species Human (GRCh38)
Location 17:52270785-52270807
Sequence TATCACTGCAACCCACAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149048082_1149048086 3 Left 1149048082 17:52270785-52270807 CCTACCTGTGGGTTGCAGTGATA No data
Right 1149048086 17:52270811-52270833 ACTAATAATGAAGAAGGCAGCGG No data
1149048082_1149048088 21 Left 1149048082 17:52270785-52270807 CCTACCTGTGGGTTGCAGTGATA No data
Right 1149048088 17:52270829-52270851 AGCGGTCTATCCTTGCTCAAGGG No data
1149048082_1149048087 20 Left 1149048082 17:52270785-52270807 CCTACCTGTGGGTTGCAGTGATA No data
Right 1149048087 17:52270828-52270850 CAGCGGTCTATCCTTGCTCAAGG No data
1149048082_1149048085 -3 Left 1149048082 17:52270785-52270807 CCTACCTGTGGGTTGCAGTGATA No data
Right 1149048085 17:52270805-52270827 ATAGGCACTAATAATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149048082 Original CRISPR TATCACTGCAACCCACAGGT AGG (reversed) Intergenic
No off target data available for this crispr