ID: 1149048525

View in Genome Browser
Species Human (GRCh38)
Location 17:52276785-52276807
Sequence AACTCCAGGTAGCAGCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149048523_1149048525 10 Left 1149048523 17:52276752-52276774 CCACAGCACACTAGCTCAAATCT No data
Right 1149048525 17:52276785-52276807 AACTCCAGGTAGCAGCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149048525 Original CRISPR AACTCCAGGTAGCAGCCTGT AGG Intergenic
No off target data available for this crispr