ID: 1149052675

View in Genome Browser
Species Human (GRCh38)
Location 17:52325479-52325501
Sequence ACTAGGCAGTGCCCCAGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149052668_1149052675 21 Left 1149052668 17:52325435-52325457 CCATTCTGGGCTCTGGAGGATGA 0: 3
1: 87
2: 1029
3: 1463
4: 1896
Right 1149052675 17:52325479-52325501 ACTAGGCAGTGCCCCAGTAAGGG No data
1149052671_1149052675 -6 Left 1149052671 17:52325462-52325484 CCTCTTCTCATAGCTCCACTAGG 0: 153
1: 1874
2: 2053
3: 1331
4: 808
Right 1149052675 17:52325479-52325501 ACTAGGCAGTGCCCCAGTAAGGG No data
1149052670_1149052675 -5 Left 1149052670 17:52325461-52325483 CCCTCTTCTCATAGCTCCACTAG 0: 165
1: 1953
2: 2073
3: 1213
4: 828
Right 1149052675 17:52325479-52325501 ACTAGGCAGTGCCCCAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149052675 Original CRISPR ACTAGGCAGTGCCCCAGTAA GGG Intergenic
No off target data available for this crispr