ID: 1149055362

View in Genome Browser
Species Human (GRCh38)
Location 17:52356842-52356864
Sequence TGCCCTGCCCCCAGGGCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149055357_1149055362 -8 Left 1149055357 17:52356827-52356849 CCTTTTCTTCAGCTATGCCCTGC 0: 8
1: 895
2: 817
3: 1174
4: 1532
Right 1149055362 17:52356842-52356864 TGCCCTGCCCCCAGGGCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149055362 Original CRISPR TGCCCTGCCCCCAGGGCGTG GGG Intergenic
No off target data available for this crispr