ID: 1149058279

View in Genome Browser
Species Human (GRCh38)
Location 17:52390606-52390628
Sequence TCCTGCTGACCCACAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149058279_1149058285 24 Left 1149058279 17:52390606-52390628 CCTGGGCTTGTGGGTCAGCAGGA No data
Right 1149058285 17:52390653-52390675 GGAATGTAAGATTTACATTTTGG No data
1149058279_1149058287 26 Left 1149058279 17:52390606-52390628 CCTGGGCTTGTGGGTCAGCAGGA No data
Right 1149058287 17:52390655-52390677 AATGTAAGATTTACATTTTGGGG No data
1149058279_1149058284 3 Left 1149058279 17:52390606-52390628 CCTGGGCTTGTGGGTCAGCAGGA No data
Right 1149058284 17:52390632-52390654 GTGTGGTGTCTCTCAGCTATGGG No data
1149058279_1149058283 2 Left 1149058279 17:52390606-52390628 CCTGGGCTTGTGGGTCAGCAGGA No data
Right 1149058283 17:52390631-52390653 GGTGTGGTGTCTCTCAGCTATGG No data
1149058279_1149058286 25 Left 1149058279 17:52390606-52390628 CCTGGGCTTGTGGGTCAGCAGGA No data
Right 1149058286 17:52390654-52390676 GAATGTAAGATTTACATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149058279 Original CRISPR TCCTGCTGACCCACAAGCCC AGG (reversed) Intergenic
No off target data available for this crispr